the evolution of c

Stringing in the Key of C#

Ngày tải lên : 04/10/2013, 21:20

... included in the substrings created, which has the effect of removing the character(s). The logic is much simpler and less error-prone. The foreach loop in the second half of the program puts the ... to the end of the string: “cd,e” . (It’s the “+ 1” that skips the comma.) The Concat() function puts the two substrings back together to create “abcd,e” . Control passes back up to the top of ... RemoveSpecialChars() function // from RemoveWhiteSpace program // RemoveSpecialChars - remove every occurrence of the // specified characters from the string public static string RemoveSpecialChars(string...

24
466
0

Tài liệu The Evolution of Internet Telephony pptx

Ngày tải lên : 20/12/2013, 17:15

... have the option to put my current call on hold and answer the incoming call, or I can ignore the incoming call. Best case scenario, my service provider may offer me the option of sending the call ... and exceedingly slow access, as well as the basic issue of limited PC deployment. In the early 1990s, however, several factors coincided to cause the Internet to become a viable commercial platform: ... with the UC Berkeley Computer Science department and School of Information and Management Sciences. As more applications such as multimedia, telephony and electronic commerce move to the Internet,...

25
485
2

Tài liệu Combat Pair - The Evolution of Air Force-Navy Integration in Strike Warfare ppt

Ngày tải lên : 17/02/2014, 23:20

... matter of standard practice. 6 Finally, in the realm of doctrine, there was an emergent Navy acceptance of the value of strategic air campaigns and the idea that naval air forces must become ... Control, Communications, and Computers CAFMS Computer-Aided Flight Management System CAS Close Air Support CAOC Combined Air Operations Center CAP Combat Air Patrol CCIP Continuously Computed Impact ... integration because, with approximately 500 lb less internal fuel-carriage capacity occasioned by the space taken up by the aft cockpit for the second crewmember, that aircraft is operationally incompatible...

129
388
0

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Ngày tải lên : 18/02/2014, 17:20

... provided evidence that the c rings contain both types of c subunits. The stoichiometry for c 2 ⁄ c 3 : c 1 was 9 : 1. Furthermore, this stoichiometry was independent of the carbon source of the growth ... and C- terminal helices of the c ring, respectively. The C- terminal helices show a clear handedness, and two of the rings face in the opposite direction in the membrane to the other two, forming the same ... operon of the anaerobic, acetogenic bacte- rium Acetobacterium woodii is unique because it encodes two types of c subunits, two identical 8 kDa bacterial F 0 -like c subunits (c 2 and c 3 ), with...

9
773
0

Tài liệu FINANCIAL ENGINEERING The Evolution of a Profession pptx

Ngày tải lên : 18/02/2014, 18:20

... address soci- ety’s needs. At a macroeconomic level financial engineering helps improve the allocation of scarce resources. Allocation of resources is the fundamental objective of any economic system. ... and approximately 30 articles to fully describe the current state of financial research and practice in a particular area of finance. The essays in each volume are intended for practicing finance professionals, ... OPEC increased price of oil due to the devaluation of U.S. dollar—received less real income, and political conflicts in the Middle East at the time also spurred unpredictable changes in oil prices. Multinational...

615
735
0

**Tài liệu Constraining Hypotheses on the Evolution of Art and Aesthetic Appreciation* doc**

Ngày tải lên : 19/02/2014, 17:20

... not others. Hence, the question of the evolution of aesthetic preference becomes the question of the evolutionary history of those components, their neural bases, and their interaction. A consequence ... affective state during aesthetic preference, has revealed two major modifications in cytoarchitecture: the appearance of two novel cytoarchitectonic brain areas, and the clustering of a kind of ... humans. THE PRODUCT OF GENES AND CULTURE The fact that structural and cytoarchitectonic modifications of the brain that occurred throughout the human lineage owe, ultimately, to changes in the develop - mental...

27
672
1

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Ngày tải lên : 19/02/2014, 17:20

... following the manufacturer’s protocols. PCR pri- mers located in the second and third exons of the human CRYGN gene were used for ampliﬁcation: NgcdsA, TCTC TATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTC CCCGTACACCTTGATGGTGTTC. ... Life Technologies (now Invitrogen). Libraries were screened for human cN-crystallin expression by PCR, using these prim- ers: NgcdsA, TCTCTATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTCCCCGTACACCTTGATGGTGTTC. ... CCGTCCCCGTACACCTTGATGGTGTTC. The following oligonucleotides were used as bait to hybridize clones from the positive library: Hngtrap1, ATGAACCGA GTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTG GAACAGCCACA. The resultant clones...

16
561
0

THE EVOLUTION OF THE RUSSIAN SAVING BANK SECTOR DURING THE TRANSITION ERA docx

Ngày tải lên : 06/03/2014, 10:20

... and performance. 7 3. Scale advantages causing increased concentration The most obvious cause of a steady increase in the rate of market concentration is the existence of important scale or scope economies. ... index, the largest market share (C1 ), the C4 and C8 concentration ratios and the average licency date. The Sberbank is excluded when computing the average licency date. Table 2: The firms in the ... upon the date of licency for saving activities. 11 Class 1 means that the banks have the oldest licency date and class 4 means that the banks have the newest licency date. The value of i D is then...

26
334
0

Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

Ngày tải lên : 07/03/2014, 09:20

... respectively, whereas no signiﬁcant activity was detected with NADPH. This cofactor preference is consistent with the presence and absence of speci c amino acids at certain positions in the amphioxus enzymes ... Leica confocal microscope (Leica Microsystems GmbH, Wetzlar, Germany), and those of RDH2-b-galactosidase constructs were done with a Zeiss Axiophot ﬂuorescence microscope (Carl Zeiss, Oberkochen, ... of the signaling sequence, but rather contained the L24ERGR motif at the C- terminus of the hydrophobic sequence, thereby resembling the R19ERQV, R19ERKV, R19VRQV and R19DRQ(S ⁄ C) sequences of...

14
477
0

The Evolution of Modern Medicine pot

Ngày tải lên : 08/03/2014, 14:20

... experience, the collection of facts, the evidence of the senses, the avoidance of philosophical speculations, were the distinguishing features of Hippocratic medicine. One of the most striking contributions ... gives an account of the trial of Apollonius of Tyana,[16] accused of human hepatoscopy by sacrificing a boy in the practice of magic arts against the Emperor. " ;The liver, which the experts ... Freedom the Note of Directness the Note of Humanism the Note of Sanity and of Many-sidedness. Upon some of these characteristics we shall have occasion to dwell in the brief sketch of the rise of scientific medicine...

93
517
0

Oxygen and the Evolution of Life pptx

Ngày tải lên : 14/03/2014, 10:20

... in the cell nucleus, RNA, also a nucleic acid, transfers a copy of a particular part of the DNA from the cell nucleus to the cytosol. This serves as a matrix for the synthesis of proteins, composed ... the two interacting molecules on the path to completion of the reaction) can be formed. The transition state often involves one molecule temporarily acce pting a pair of electrons from the other. ... packed, one ball coordinates w ith 12 other balls and 74% of the space is occupied. However, in ice, only 42% of the volume is occupied by water molecules. Thus, ice has a lot of empty space;...

177
3.4K
1

The evolution of host use and unusual reproductive strategies in Achrysocharoides parasitoid wasps pot

Ngày tải lên : 14/03/2014, 16:20

... indeed the ancestral host of Achryso- chroides. Regarding the effect of taxa sampling on the reconstruction of reproductive strategies, although the biology of most species in other parts of the ... spurious ancestral character state reconstructions. In our study, we included 15 Achrysoch- aroides species, which comprise a third of known species of this genus. Regarding the effect of taxa sampling ... 1998). Discussion Radiation of Achrysocharoides parasitoids Achrysocharoides provides an interesting case of ‘ecolog- ical speciﬁcity’, because most species attack Phyllono- rycter moths conﬁned...

13
620
0

The Evolution of Cells potx

Ngày tải lên : 14/03/2014, 21:20

... composed of cells, and the business of a cell is chemistry. Our human cells contain the same chemical compounds and undergo similar chemical pro- cesses as the cells in the corn we eat and the ... explora- tion of some basic principles of organic chemistry and an explanation how they have contributed to the development of cells of increasing complexity. CARBON, THE BACKBONE OF LIFE Cells are composed ... area of biological research. Enzymes are a large group of proteins that act as catalysts for bio- chemical reactions. Catalysts function by coming in close contact with other molecules and accelerating...

123
617
0

THE EVOLUTION OF CAPITALISM SYSTEM OF ECONOMICAL CONTRADICTIONS OR, THE PHILOSOPHY OF MISERY potx

Ngày tải lên : 15/03/2014, 07:20

... discloses the profound laws of civilization. The ancient philosophers and the Fathers of the Church, who must be regarded here as the representatives of socialism in the early centuries of the ... spirit of the social compact, is necessarily presupposed. On the other hand, the indemnity, or the price of the article taken, is fixed, not by the intrinsic value of the article, but by the general ... immediately, as necessary to the comprehension of chemical phenomena, a series of entities no less obscure,—vital force, chemical force, electric force, the force of attraction, etc. (pp. 146, 149)....