... DataStat, a nationally-based survey administration firm located in Michigan, was contracted to administer the California SCHIP statewide mail survey DataStat mailed the PedsQL™ 4.0 survey, together ... (22.2%) Hispanic/Latino, (9.7%) Black/African American, (9.7%) Asian/Pacific Islander, 2(2.8%) Native American or Native Alaskan, and (12.5%) missing The statewide SCHIP sample was representative of ... design, and performed the statistical analysis All authors read and approved the final manuscript Acknowledgements This research was supported by a grant from the David and Lucile Packard Foundation...
... Piedras Feria 142 The creative economy and the development possibilities in Argentina Facundo Solanas 160 Creative economyasa strategy for Jamaica and the Caribbean growth and wealth generation ... as Guaramiranga, with its Jazz and Blues Festival, and Paraty, with FLIP (the International Literary Festival of Paraty) as examples (read text by Ana Carla Fonseca Reis) There should be further ... products and services will be sent abroad.” On the other hand, Latin America and the Caribbean together did not exceed a 3% market share, whereas Australasia and Africa accounted for 1% of global exports...
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... verbal analogy problems, yielding 47% accuracy The same approach is applied to classifying noun-modifier pairs: using the Diverse dataset of Nastase and Szpakowicz (2003), Turney&Littman achieve ... (container, content, equative, material, measure, topic, type) For example, exam anxiety is classified as effect and therefore as CAUSALITY, and blue book is property and therefore also PARTICIPANT...
... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic intermarriage in the US ... postdated the Internet revolution by more than a decade, the data offer a unique opportunity to assess the impact of the Internet on the way Americans meet their romantic partners The fact that Americans...
... trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again the vacation It was like a train going in and out ... It was only for cod I’m sorry The face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another ... dead things The prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist asa Young Man he was to get up and...
... English asa lingua franca in teaching Chinese asa foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter in international ... strategies”); and asa heritage and community language in the diasporas across the world, such asthe United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal...
... English asa lingua franca in teaching Chinese asa foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter in international ... strategies”); and asa heritage and community language in the diasporas across the world, such asthe United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal...
... English asa lingua franca in teaching Chinese asa foreign language: A case study of native Chinese teachers in Beijing In Language alternation, language choice and language encounter in international ... strategies”); and asa heritage and community language in the diasporas across the world, such asthe United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal...
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... the work on the spot, and, as capital is usually forthcoming, the estancias are run in such a way as to yield the greatest possible return They are usually well-maintained, up-to-date in management ... seed alfalfa is sown as well When the last crop has been cut, the latter grows through the stubble The growth of this plant is such that as alfalfa is more cultivated, the stock-bearing capacities...
... & Mauritz, and England’s Jaeger and Laura Ashley, have attempted to supply fashionable clothes at lower prices, none has succeeded as well as Spanish clothes maker, Zara, whose sales have soared ... recent The Manager asa Planner and Strategist 277 years.51 Zara has managed to position itself asthe low price/cost leader in the fashion segment of the clothing market because of the way it ... products and uses a different marketing approach than its North American division Global and multidomestic strategies both have advantages and disadvantages The major advantage of a global strategy...
... metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs ... consider them as ancestral chromosomes although they are very rare in fish and batracians Indeed, they could have been inherited from a common ancestor of the vertebrates, as they can be encountered ... making it a reference for the detailed study of bird genomes THE CHICKEN KARYOTYPE Although the boundary between macro- and microchromosomes varies according to authors, the actual standard karyotype...
... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well asthe region surrounding ... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... TB, Assael LA, Landesberg R, Marx RE, Mehrotra B: American Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related osteonecrosis of the jaws–2009 update J Oral Maxillofac...
... endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared complete The patient ... Endometriomas appear homogeneously hyperintense on T1-weighted sequences [10] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed ... of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these cases...
... across the nine ICF activities and participation domains The Friedman analysis is a nonparametric statistical test which is an alternative to the repeated analysis of variance measure Statistical ... cm cardboard, cut out and laminated and velcro was attached to the back for easy placement on a regular short pile mat These line drawings could then be placed by the participants on the mat under ... its design, statistical analysis and drafted the manuscript MG and AVDM participated in its design, data collection and statistical analysis All authors read and approved the final manuscript Competing...
... Futamura T, Toyooka K, Iritani S, Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and ... state and leaves open the possibility that the opposite may be true that FGFs may be increased - in more manic states, giving an overall mixed picture in brains from bipolar patients Asa caveat, ... of mania [20] Anabolic steroids, which not only increase muscle mass but also increase the levels of growth factors such as insulin-like growth factor in many parts of the body [21], also have...
... for research paper WBS is foundation for project schedule Building a PERT/CPM Chart Assists in assigning tasks Critical path method Gantt chart and tracking GANTT chart Systems Analysis and Design ... Overlap of SDLC Phases with Ongoing Project Management Tasks Systems Analysis and Design in a Changing World, 3rd Edition 10 Project Management Tasks Corresponding to Phases of the SDLC Systems Analysis ... 17 Activities of the Project Planning Phase Systems Analysis and Design in a Changing World, 3rd Edition 18 Activities of the Project Planning Phase and Their Key Questions Systems Analysis and...
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... On the other hand, DMSO was the only chemical which reduced larval activity in the dark and was among the two substances (the other was SB) that exhibited the same effect in the light phase The...
... expenditures,neoclassicaltheory emphasizescost of capital,modifiedneoclassicaltheoryemphasizescost of capital and output, cash flow theory emphasizesinternalfinance, and the Q theory emphasizesthe q ratio ... though the information-theoreticapproach assumes the prevalence of capital market constraints and financing hierarchy, it is cast in a neoclassical framework with the usual assumption that managers ... profitabilityrather than increased cash flow One solutionproposed by Fazzari et al (1988) isto use the q ratio asa measure of the expectedprofitability and cash flows asa measure of the availability of...