the economic consequences of a prolonged drought in the southern murray darling basin
The Economic Consequences of a War with Iraq
Ngày tải lên :
09/01/2017, 20:45
... humanitarian assistance was the case of Bosnia and Herzegovina (including Republika Srpska) during the 1990s Humanitarian assistance in the country was $5 - billion during the war and $7 - billion in the ... assistance are uncertain because they involve knowing the population at risk, the level of need after the war, and the duration of the assistance One benchmark for estimating the cost of humanitarian ... take a back seat as the U.S deals with war and peace in Iraq Notwithstanding all the warning signs, the administration marches ahead, heedless of the fiscal realities and undeterred by cautions...
- 42
- 413
- 0
Economic Evaluation Of A Warehouse Investment In Central Europe Case Study At Nokian Heavy Tyres Ltd.
Ngày tải lên :
12/12/2016, 20:34
... carried out in own factories located in Nokia, Finland and in Vsevolozhsk, Russia The company has also set up off-take contract manufacturing in Indonesia, China, India, Spain and in the USA As ... Nevertheless, defining size of a warehouse merits further exploration mainly due the fact that the size of a facility has an impact on the cost level There are many factors influencing how large a warehouse ... operations, whereas handling within receiving to shipping in automated system is automated Combination of mechanized and automated handling is used in semiautomated systems The scope of the information-directed...
- 59
- 290
- 0
Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc
Ngày tải lên :
13/02/2014, 16:20
... several large ethnic groups in The Gambia (Singhateh 1985) A national campaign to eliminate FGC in The Gambia was launched in 1997 In the same year, the government banned national radio and television ... partial or total removal of the clitoris together with partial or total excision of the labia minora Type III is partial or total removal of the external genitalia and stitching or narrowing of ... not included as we feared that they might lower the participation rate in a study that was already sensitive because of the gynaecological examination Therefore the only data collected pertaining...
- 11
- 558
- 0
THE ECONOMIC CONSEQUENCES OF AGEING POPULATIONS (A COMPARISON OF THE EU,US AND JAPAN) ppt
Ngày tải lên :
23/03/2014, 21:20
... and Japan respectively (Graph 1) These increases in the overall total reflect a broadly stabilising youth ratio and a sharp increase in the old age share of the total As regard the latter old age ... annual average rate of growth, relative to the baseline, by close to ½ a percentage point in the case of the EU and Japan and around a ¼ of a percentage point in the US In absolute terms the ... PRIVATE SAVINGS BEHAVIOUR Demographic change and private savings behaviour: Crucial to any analysis of the likely economic impact of an ageing population is its impact in terms of saving rates Ageing...
- 74
- 489
- 0
SOME ECONOMIC CONSEQUENCES OF GLOBAL AGING: A Discussion Note for the World Bank doc
Ngày tải lên :
31/03/2014, 07:20
... FIELD A LABOR INCOME, SAVINGS AND INVESTMENT Most analyses of the economics of aging emphasize labor income at older ages because of the important linkages between labor supply and aging-related institutions, ... greatly exceeds average labor income in aging societies for reasons that are, in part, a consequence of fundamental features of aging and, in part, a consequence of features of the political and ... programs An important point, however, is that changes in labor income at any age are potentially valuable for meeting the economic challenges of aging Gains in labor income during the prime working...
- 38
- 311
- 0
báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx
Ngày tải lên :
10/08/2014, 10:23
... A stratified sample of general practices in the Netherlands was adopted in order to obtain a nationally representative sample with regard to practice size and degree of urbanisation A total of ... reporting of patient safety incidents by healthcare professionals may be more appropriate for attaining a more in- depth understanding of patient safety incidents Even so, many of the reported patient ... Marineau D, et al: Patient safety in the ambulatory setting A clinician-based approach J Gen Intern Med 2004, 19(7):719-725 11 Sandars J, Esmail A: The frequency and nature of medical error in...
- 7
- 310
- 1
Economic Development of Dak Lak province in the period of industrialization and modernization = Phát triển kinh tế tỉnh Đắk Lắk trong thời kỳ công nghiệp hóa, hiện đại hóa (tóm tắt + toàn văn)
Ngày tải lên :
17/10/2014, 12:01
... Evaluation of factors affecting economic development of Daklak in the process of industrialization and modernization - Analysis of economic situation in Daklak in the period 2004-2011 according ... 2011, accounting for 24% of the area and 35.5% of the total population of the Central Highlands.Area of Daklak is ranked the second in the region (after Gia lai), the fourth/63 provinces/cities (after ... 6% of the cultivated area of the province DakLak stands in the first position of the Central Highlands Dak Lak in area and 3/22th of growing provinces of our country Cashew production also increased...
- 25
- 537
- 0
fish, fishers, seals and tourists- economic consequences of creating a marine reserve in a multi-species, multi-activity context
Ngày tải lên :
04/03/2015, 10:25
... that, because the values of parameters are arbitrary (and in particular the prices and unit costs of each activity), the indications given by the figure are qualitative The economic parameters of ... forthcoming creation of a marine national park in the Iroise sea, a coastal sea west of Brittany (France) This area is characterized by a great variety of living marine resources (Hily et al [1999]) ... for a non extractive recreative use (seal watching)6 We assume that the demand for seal watching is a non-linear increasing function of the stock of seals in the area under survey All prices are...
- 25
- 312
- 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
Ngày tải lên :
05/09/2013, 14:59
... understand the behavior of the variables involved in economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis ... projects and costs evaluation The economic assessment of hypothetical wind farm installed in Caldas da Rainha, we obtained the following results: Attractiveness Table Economic and financial indicators ... prices are updated yearly by the inflation rate considered in the analysis Table 14 Comparison in absolute values of calculated parameters in the scenarios Mean values in € of the calculated parameters...
- 14
- 416
- 1
Economic viability of a residential building integrated photovoltaic generator in South Africa
Ngày tải lên :
05/09/2013, 16:10
... usually used as a primary but as a secondary indicator of the level of risk of an investment, other investment appraisal indices were also investigated The true interest yield indicated by the AIRR ... calculated using a spreadsheet package The discount rate was used instead of the nominal interest rate The discount rate was adjusted to remove the effects of expected or actual inflation using ... effectiveness involves comparisons of computed AIRR with the investor’s minimum acceptable rate of return (MARR) In this case, the MARR is the interest cost of capital given in table The internal rate of...
- 10
- 398
- 0
Tài liệu From Burden to “Best Buys”: Reducing the Economic Impact of Non-Communicable Diseases in Low- and Middle-Income Countries pdf
Ngày tải lên :
20/02/2014, 19:20
... reduce the growing burden of NCDs: • A global analysis of the economic impact of NCDs by the World Economic Forum and the Harvard School of Public Health • An analysis of the costs of scaling up a ... China India Russian Federation Indonesia Brazil Ukraine Bangladesh Turkey Pakistan Egypt Poland Viet Nam Iran (Islamic Republic of) Mexico Philippines Thailand Myanmar South Africa Nigeria Argentina ... any damages incurred as a result of its use The designations employed and the presentation of the material in this overview not imply the expression of any opinion whatsoever on the part of the...
- 12
- 799
- 1
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
Ngày tải lên :
22/02/2014, 04:20
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation...
- 6
- 488
- 0
The economic Value of citizenship for immigrants in The united states ppt
Ngày tải lên :
08/03/2014, 06:20
... as did an earlier poll of recently naturalized Latinos in Texas See Richard Ramirez and Olga Medina, Catalysts and Barriers to Attaining Citizenship: An Analysis of ya es hora Ciudadania! (Washington, ... opportunity” as the most important reason for naturalizing Bittle and Roch, A Place to Call Home; Gonzalez-Baker et al., The Making of Americans; Ramirez and Medina, Catalysts and Barriers to Attaining ... well as Canada and Australia They range from zero in France and Spain, to $100 in Canada and $260 in Australia Higher fees prevail in the United Kingdom ($1,375), Ireland ($1,237), and the Netherlands...
- 24
- 866
- 0
THE ECONOMIC BENEFITS OF IMPROVING LITERACY SKILLS IN THE WORKPLACE pdf
Ngày tải lên :
08/03/2014, 06:20
... training and development in the workplace? First, we can take action to raise awareness of the importance and value of improving literacy in the workplace Many individuals and organizations can ... qualitative feedback on the benefits of literacy training, and discussed the impact on their organizations The Conference Board of Canada, Performance and Potential: Assessing Canada's Social and Economic ... significant Weighting the average annual incomes (from all sources) associated with each of these factors by the appropriate sample size, the average annual income of a "typical" high literacy individual...
- 15
- 812
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...
- 8
- 546
- 0
The Project Gutenberg EBook of A First Book in Algebra, pot
Ngày tải lên :
15/03/2014, 00:20
... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number ... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other at the rate of y miles an hour How far apart ... − 4a, − 3a, − 2a, a, −0, a, 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must...
- 189
- 432
- 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
Ngày tải lên :
15/03/2014, 00:20
... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage increased dramatically within 12–24 h, whereas in the PR zone the ... with the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast...
- 15
- 479
- 0
An estimation of the economic impact of chronic noncommunicable diseases in selected countries ppt
Ngày tải lên :
23/03/2014, 20:20
... compared to Canada and the United Kingdom The potential gains from the global goal scenario also increase gradually to 2015 in all countries Table 4: Annual gain in income as percentage of GDP ... capital (K) – alpha (α) was obtained from Senhadji 1999(12) There was difficulty in obtaining data for capital accumulation data for the Russia Federation; as a result, it was set to the average ... the definition of the model in explaining the empirical data on economic growth by the addition of the human capital component in addition to the labour input (9) Education capital was initially...
- 21
- 411
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
Ngày tải lên :
28/03/2014, 23:20
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0