the denial of a deficit and its relationship to consciousness

Functional study of zebrafish udu and its relationship to the notch signaling pathway

Ngày tải lên : 14/09/2015, 14:03

... p53-dependent apoptosis requires activation of the ATM-Chk2 pathway The DNA damage response pathway is a cellular surveillance system that senses the presence of damaged DNA and elicits an appropriate ... human BAF155/170, Drosophila ISWI), as well as, histone acetyltransferase (HAT) (yeast and human Ada2p) and deacetylase (HDAC) (co-REST, Mta-L2 and N-CoR) (Aasland et al., 1996; Humphrey et al., ... Nuclear co-activators such as Mastermind/SEL-8/LAG-3 (MAM), histone acetyltransferase (HAT) and p300/CBP-associated factor, form a transcriptional activated complex and activates the expression of...

212
337
0

Báo cáo khoa học:The principle of flux minimization and its application to estimate stationary fluxes in metabolic networks docx

Ngày tải lên : 07/03/2014, 15:20

... synthesis and acetyl-CoA conversion pathway 46 acetyl-CoA fi acetoac-CoA + CoA 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 48 3HB-CoA fi PHB + CoA 49 PHB fi 3HB 50 Acetoac + NADH fi 3HB + NAD 51 Acetoac-CoA ... gaining a maximal biomass production at a given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, the principle of maximal ... standard conditions For the calculation of stationary and time-dependent states of the reaction scheme in Fig 1, a comprehensive mathematical model was used that takes into account the detailed...

18
799
0

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Ngày tải lên : 23/03/2014, 21:20

... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... absorption maxima at 409 and 638 nm that are characteristic of the CO-ferrous verdohaem complex [31,37] Further exposure to air caused a loss of the absorption maxima at 340, 409 and 638 nm, and subsequent ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidiﬁcation and extraction of the product into chloroform gave biliverdin,...

9
501
0

Molecular mechanisms underlying the pathogenesis of nasal polyposis and its response to steroid treatment

Ngày tải lên : 10/09/2015, 15:49

... of nasal polyps Picture was taken from the patient with NP under endoscope examination The characteristic features of nasal polyps are large quantities of extracellular edema and an inflammatory ... cranial cavity The inferior wall is the palate which separates the nasal cavity from the oral cavity The superior, middle, and inferior turbinates (also called concha) form the lateral wall as ... GRs and the proinflammatory transcription factors, such as NF kappa B and AP-1 [Hayashi et al., 2004] For example, NF kappa B recruits transcriptional coactivators, such as CBP or p300/CBP associated...

293
379
0

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...

12
772
0

báo cáo hóa học:" The impact of iron overload and its treatment on quality of life: results from a literature review" pptx

Ngày tải lên : 20/06/2014, 16:20

... Eleftheriou A: Impact of thalassemia major on patients and their families Acta Haematologica 2002, 107:150-157 Rebulla P: Transfusion reac tions in thalassemia A survey from the Cooleycare programme The ... Psychosocial and clinical burden of thalassaemia intermedia and its implications for prenatal diagnosis Arch Dis Child 1995, 72:408-412 Caro JJ, Ward A, Green TC, Huybrechts K, Arana A, Wait S, Eleftheriou ... syndrome: a study of the cancer and leukemia group B J Clin Oncol 2002, 20:2429-2440 Arboretti R, Tognoni G, Alberti D, Thalassarmia ICG: Pharmacosurveillance and quality of care of thalassaemic patients...

6
733
0

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Ngày tải lên : 20/06/2014, 22:20

... 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl ... Cite this article as: Zireh: On the maximum modulus of a polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and beneﬁt ... Inequalities and Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial...

9
423
0

Báo cáo lâm nghiệp: "Litter production in a Quercus suber forest of Montseny (NE Spain) and its relationship to meteorological conditions" pptx

Ngày tải lên : 07/08/2014, 16:20

... statistically analyse interannual and seasonal variation of litterfall in a cork oak forest of the Montseny massif (Catalonia, north-eastern Iberian Peninsula) and its relationship with meteorological ... photosynthesis, and this tends to be during the spring and part of the autumn During and after the appearance of shoots, the plant discards the old leaves, once the translocation of the nutrients has ... to any of the remaining ten variables (P >> 0.05) and for this reason it appears in the centre of the factor plot The largest factor loadings for the two axes were for mean temperature and rainfall...

10
377
0

báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

Ngày tải lên : 12/08/2014, 03:20

... LG of the AA map, B6 with A6 and A1 0, and B7 with A7 and A8 Synteny analysis A total of 51 common markers mapped in the AA and BB genome diploid maps spanned the 10 linkage groups of both maps ... development and analysis, and participated in drafting the manuscript Additional material Additional File Data of crossings between A ipaënsis (accession K30076) and A magna (K30097) The data provides the ... results and their relationship in understanding the origins of Arachis hypogaea L In Annals of the III SIRGEALC – Simpósio de Recursos Genéticos para a América Latina e Caribe Londrina, Paraná, Brazil;...

10
399
0

Báo cáo khoa học: "Bench-to-bedside review: The role of activated protein C in maintaining endothelial tight junction function and its relationship to organ injury" pot

Ngày tải lên : 13/08/2014, 03:20

... was attributed to inhibition of the proapoptotic transcription factor p53, normalization of the proapoptotic Bax/Bcl-2 ratio, and reduction of caspase-3 signaling, all of which decreased apoptosis ... anti-inflammatory and antiapoptotic effects of APC are summarized in Figure Other investigators have also documented a direct antiapoptotic effect of APC Using human brain endothelium in a stroke ... inflammatory response in endothelium and monocytes by modulating nuclear factor-kappaB Crit Care Med 2002, Suppl:S288-S293 Iba T, Kidokoro A, Fukunaga M, Nagakari K, Shirahama A, Ida Y: Activated...

6
201
0

Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx

Ngày tải lên : 14/08/2014, 19:22

... RNA that contains the retroviral packaging signal (ψ) and so made amenable to molecular manipulation The genetic structure of the virus is such that the viral cis (sequences that are biologically ... means that this has already happened The Tat dependence of the HIV-1 LTR may also provide an extra measure of safety as long as Tat is not transferred along with the vector However, the enhancing ... of mammary epithelial cells, the eventual site of tumour formation Although Sag is a major determinant of the oncogenic potential of MMTV it should be noted that in the final analysis malignancy...

13
498
0

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

Ngày tải lên : 14/09/2015, 14:01

... of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is pointing perpendicularly out of the image plane 122 The ... slab Slab thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data ... sides of the layer and the SPP energy density is enhanced because of a lateral compression of the SPP wavelength due to a gradual increase in the phase velocity of the SPP as it approaches the...

163
449
0

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1

Ngày tải lên : 14/09/2015, 14:02

... colleagues at Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and ... 12 A schematic sketch of the cavity system considered in this chapter The distance of the center of the cavity to the surface is h The major and minor axis of the cavity are ˆ denoted as a and ... in the folding and stabilization of a protein (42, 43) These bonds are generally weak in the infrared but are Raman-active Other questions answerable by the Raman technique are related to ligand...

129
265
0

River Water Quality Analysis of Hadano Basin and its Relationship with Nonpoint Sources of Pollution

Ngày tải lên : 05/09/2013, 10:17

... population (person), agriculture area (m2), urban area (m2) and forest area (m2) In the case of agriculture area, as it contains paddy field and cultivated land, the total area was calculated as an ... respective drainage basins were taken as explanatory variables In the case of agriculture area, as in the simple regression analysis, the total area was calculated as an equivalent area based on the unit ... monitoring stations and the corresponding river basins No Monitoring Station Chimura Ishiuchiba Neshitabashi Sakagawa (Tributary) Yamanokami Minasebashi Sakurabashi Shintokiwabashi Sakurazawabashi 10...

28
593
0

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Ngày tải lên : 19/02/2014, 16:20

... pTRIDENT-14neo vectors such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred to Immobilon-P ... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against...

9
622
0

The Savings and Loan Crisis and Its Relationship to Banking pptx

Ngày tải lên : 06/03/2014, 10:20

... Owners Loan Act of 1933 empowered the FHLBB to charter and regulate federal savings and loan associations Historically, the Bank Board promoted expansion of the S&L industry to ensure the availability ... 177 An Examination of the Banking Crises of the 1980s and Early 1990s Volume I Reagan administration, the FHLBB and the Office of the Comptroller of the Currency approved any application as long ... interest-rate premiums (that is, the spread over comparable Treasury bill rates) and the capital -to- assets ratio and measures of S&L risk exposure for both wholesale and retail deposits In the case of...

22
446
0

The Modulation of Optical Property and its Correlation with Microstructures of ZnO Nanowires ppt

Ngày tải lên : 22/06/2014, 00:20

... equal to the band gap of ZnO crystal, some electrons in the valence band (VB) can be excited to the conduction band (CB) to form the photo-generated electrons in the CB and the same amount of ... The SAED patterns of the circled area in Fig 5a were taken along [010] zone axis The sharp diffraction spots indicate that 1187 Fig a TEM image of ZnO nanowire annealed at 500 °C in the air atmosphere ... ZnO nanowires grown in air atmosphere due to the abundant oxygen vacancies too The photocatalytic degradation of MO obeys the rules of the ﬁrst-order kinetic reaction and the rate constants were...

8
398
0

Báo cáo hóa học: " Research Article On a Class of Parametric Transforms and Its Application to Image Compression" ppt

Ngày tải lên : 22/06/2014, 20:20

... Hadamard-like and Haar-like transforms, which are of a particular interest since they are generalizations of the classical Hadamard and Haar transforms Deﬁnition Within the class Ω consider the family Ω of ... Figure 12 allows also automatic generation of transform parameters meaning that the transform may automatically be adapted to the input signal or image CONCLUSION A new class of parametric transforms ... 2: The fast Hadamard-like transform of order N = 11 Figure 3: The fast Haar-like transform of order N = 11 The classical Hadamard transform belongs to the family Ω of Hadamard-like transforms and...

14
484
0

Báo cáo khoa học: "The incidence of recurrent flushing and its effect on branch production in Quercus petraea (Matt) Liebl growing in southern England" ppt

Ngày tải lên : 08/08/2014, 23:22

... years and the difference was not always statistically significant As recurrent flushes of growth are usually restricted to the areas of most vigorous growth, such as the leader and tips of the major ... study The major crown branches and the leading shoot were then cut from each tree The leading shoot was defined as that part of the main stem between the tip and the junction with the main stem of ... 0.01).However, as there was large variation between years there statistically significant difference in was no the overall mean values for branches (59%) and leaders (68%) shown in table I The viability of...

9
324
0

Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx

Ngày tải lên : 09/08/2014, 02:21

... oaks and several acacias, which show marked differences in shoot growth and ramification Materials and Methods Acorns of oaks (Quercus petraea Liebl., Q rubra du Roi) and seeds of acacias (Acacia ... Statistical studies of these ture are data allow the determination of elongation laws and branching patterns They may then be integrated into a deterministic three-dimensional model (Pages and ... number of lateral roots and rate of extension are greatly increased by mutilation of the taproot tip (Hackett, 1971) In the same way, effects of water stress on lateral root initiation and elongation...

6
362
0