the delivery of a packet at the network layer is host to host
Báo cáo y học: "Delivery of a baby with severe combined immunodeficiency at 31 weeks gestation following an extreme preterm prelabour spontaneous rupture of the membranes: a case report" pps
Ngày tải lên :
11/08/2014, 17:21
... neonatal facilities She stayed at the centre until her transfer back to her local hospital at 28+5 Erythromycin was discontinued at 25+6 weeks gestation, maternal clinical and laboratory signs of ... SROM at 14 weeks may be appropriate if the mother is well-informed of the risks for the neonate The conclusions of the ORACLE trials [4,5] indicated that a course of oral erythromycin is the antibiotic ... specialist genetic centre indicated that this was an Xlinked condition and the woman is a carrier of the mutation c.283G >A (W90X) in exon of her IL2RγC gene She was advised of a 50%-risk of any...
- 4
- 309
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
Ngày tải lên :
20/02/2014, 23:20
... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were found to ... substrate and that E1aTyr281 and, to a lesser extent, E1aAsp276 and E1aArg282, have some effect on the decarboxylation of pyruvate and the reductive acetylation of the tethered lipoyl domain in the...
- 10
- 459
- 0
An Investigation into the Implementation of a Brewpub at the New Student Union Building docx
Ngày tải lên :
08/03/2014, 23:20
... affects the environment positively as well as reducing disposal costs Another alternative for wastewater treatment is to transport the waste water to the Iona Island Sewage Treatment facility via the ... Typically, a technology system known as the GEA Westfalia Separator is mostly used for waste water treatment (GEA, 2012) It consists of decanters and separators operating continuously that are efficient ... aspects of the environment assessment of the brewpub that will be discussed are wastewater, waste grain, and energy in the refrigeration and chilling process 2.1 Wastewater Wastewater is a major...
- 23
- 481
- 0
Báo cáo sinh học: " A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data" pdf
Ngày tải lên :
12/08/2014, 17:20
... into mathematical, statistical, and probabilistic models of networks For example, GEO [1] and ArrayExpress [2] are public repositories of well-annotated and curated transcript profiling data ... [34] that is solved by formulating a Linear Program (LP) A virtue of this LP-based approach is that the use of the Huber loss function reduces the impact of variation in the training data on the ... setting, the T transcript profiles in the data matrix E are assumed to be unrelated and so independent of one another In the linear interaction model, the abundance value of a gene is treated as a weighted...
- 15
- 392
- 0
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx
Ngày tải lên :
14/08/2014, 19:22
... enabling the use of lower doses and thereby reducing the risks in the clinical application of DNA vaccines Nowadays, one of the alternatives to reduce the amount of the plasmid administered is ... Information, Bethesda, MD, USA) Transformation of E coli with µg of wild type pcDNA3-hsp65 was used as positive control of transformation Methylation status of plasmid DNA Of the total cellular DNA ... Subsequently, RNA was extracted with chloroform and precipitated with isopropyl alcohol The DNA was isolated by ethanol precipitation of the interphase and phenol phase The precipitated DNA was washed...
- 10
- 243
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
Ngày tải lên :
07/03/2014, 09:20
... lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role of the third metal in catalysis In ... water molecule with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis in HsSTP is His62, which may act ... interactions to those described here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the...
- 10
- 542
- 0
Báo cáo y học: "Standards of evidence in chronobiology: critical review of a report that restoration of Bmal1 expression in the dorsomedial hypothalamus is sufficient to restore circadian food anticipatory rhythms in Bmal1-/- mice" pot
Ngày tải lên :
10/08/2014, 09:20
... that the waveform in Fig S3D (Figs and here) is misaligned and that temperature rises in anticipation of mealtime at least an hour earlier than this figure suggests The data therefore appear to ... placed on the metal bars of the cage top, requiring the mice to reach up to bite off pieces to eat A reasonable concern, therefore, is that any attenuation of food anticipatory rhythms in Bmal1-/- ... misaligned relative to the other This misalignment issue exists regardless of whether these are temperature data or are activity data mistakenly labeled in Figure from Moriya et al [16] The thermogenic...
- 13
- 349
- 0
Báo cáo y học: "The establishment of a primary spine care practitioner and its benefits to health care reform in the United States" docx
Ngày tải lên :
13/08/2014, 15:21
... communication of findings may also help avoid the iatrogenic disability that can arise as a result of the medicalization of imaging findings that are of questionable clinical significance, such as “disc ... comprehensive care and management of a designated patient population under a risk-sharing agreement However, there is a projected gap between the availability of traditional PCPs and societal needs in the ... [63,64] An appreciation of minimalism in spine care: The primary spine care practitioner would have to understand that often in spine care “less is more” That is, an approach that focuses on education...
- 11
- 446
- 0
The Network Society - From Knowledge to Policy ppt
Ngày tải lên :
14/03/2014, 21:20
... the network society: the rise of a new form of state that gradually replaces the nation-states of the industrial era This is related to globalization, that is the formation of a network of global ... network state, but this is a tool of performance rather than a determining factor The transition from the nation-state to the network state is an organizational and political process prompted by the ... networking as the organizational form of the public sector This is tantamount to the reform of the state Indeed, the rational bureaucratic model of the state of the industrial era is in complete contradiction...
- 460
- 455
- 0
Báo cáo khoa học: The activation of gelsolin by low pH The calcium latch is sensitive to calcium but not pH docx
Ngày tải lên :
23/03/2014, 21:20
... presence of EGTA Analysis of these data shows that the fluorescence intensity decrease, extrapolated to infinite concentration, is about 15% An estimation of the apparent Kd (1 lM) can be obtained (Table ... being rather large At low pH, the helical latch could be the rate limiting step in the kinetics of activation Alternatively, pH induced conformational changes within or between other domains of gelsolin ... contrast, at pH 5.7 and with mM EGTA, a weak interaction was observed and a Kd of about lM was estimated (Fig 8) Fig Effect of pH on the binding of G4-6 to coated G-actin monitored by ELISA G4–6 was...
- 8
- 320
- 0
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx
Ngày tải lên :
21/06/2014, 18:20
... OpenAirInterface platform are its usage as measurement platform or as an emulation platform which allow to study different aspects of a wireless network in isolation In the emulation mode, the physical layer ... structure as distributed MIMO transmission In the latter case one spatial stream is used at each source and the second stream originates in another part of the network, either in the same cluster or an ... antenna This way each stream can access all the degrees of freedom of the channel In the case of two spatial streams the STF parser guarantees that both streams use different antennas in the same time/frequency...
- 16
- 768
- 0
Báo cáo sinh học: "Dynamic rerouting of the carbohydrate flux is key to counteracting oxidative stress" pot
Ngày tải lên :
06/08/2014, 18:21
... Additional data file Additional data files Additional data are available with this article online Additional data file contains details of the C elegans experiment Additional data file contains a figure ... metabolic pathways that are associated with glycolysis and the PPP PPP activity is a regulator of normal lifespan of S cerevisiae and C elegans Much evidence exists that oxidative damage to diverse ... activity This implies that rerouting of the metabolic flux is a basic mechanism in counteracting oxidative stress that is naturally switched on in the course of GAPDH inactivation Mathematical modeling...
- 18
- 286
- 0
Báo cáo y học: "Fluvoxamine may prevent onset of psychosis: a case report of a patient at ultra-high risk of psychotic disorde" ppt
Ngày tải lên :
09/08/2014, 01:21
... Ethical approval The treatment of the reported case was made according to standard clinical practice, and ethical approval was obtained from the Ethics Committee of Sodegaura Satsukidai Hospital, ... and Masaomi Iyo1,3 Department of Psychiatry, Chiba University Graduate School of Medicine, Chiba, Japan Department of Psychiatry, Sodegaura Satsukidai Hospital, Chiba, Japan Division of Clinical ... (attenuated psychosis group) under the criteria of the Comprehensive Assessment of At- Risk Mental States [4] His fluvoxamine dose was increased to 125 mg/day Then, month later, he began to relax his...
- 8
- 356
- 0
Báo cáo y học: "The dimerization domain of HIV-1 viral infectivity factor Vif is required to block virion incorporation of APOBEC3G" ppsx
Ngày tải lên :
13/08/2014, 05:22
... and these particles had reduced infectivity The data demonstrate that Vif dimerization plays an essential role in regulating hA3G and validate the multimerization domain of Vif as a potential ... days of the spreading infection assay The Inhibitor Concentration, IC (indicated within each histogram) was calculated relative to the untreated virus control (data not shown) All subsequent analyses ... microtiter plate and 15 μL of virus containing supernatant were added and mixed The plate was incubated at 37°C in a humidified incubator and incubated for 90 Following reaction, 10 μL of the reaction...
- 11
- 345
- 0
Achilles design of a high capacity mesh network with directional antennas
Ngày tải lên :
26/09/2015, 10:51
... directional capabilities The relative gain of an antenna is commonly used In relative gain, the antenna radiation power at a point is compared to that of a isotropic radiator if the same power was ... directional and omnidirectional antenna, courtesy wikipedia.com Antennas are often compared against a hypothetical isotropic radiator An isotropic radiator is a loss-less antenna having equal radiation ... elevation plane An antenna pattern is used to show the behaviour of a given antenna In general, two patterns are specified for each antenna: the azimuth pattern, and the elevation pattern The azimuth...
- 118
- 245
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. I. Trees and forest floor daily transpiration" ppsx
Ngày tải lên :
08/08/2014, 00:22
... settings The study area is located in the South of Belgium (50° 06’ N, 4° 16’ E; Fig 1) at an elevation of 260 m Topography is flat Climate is humid temperate with mean annual precipitation of 960 ... that this device integrates soil evaporation as well: output is rather the herb layer evapotranspiration Forest floor LAI was estimated by collecting all leaves in each plot on m2 areas in May, ... the control one) The importance of LAI as a limiting factor of stand transpiration has been demonstrated [19] For each year and each plot, T/LAI was calculated for oaks and was always < 0.3 Except...
- 10
- 365
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. II. Daily actual evapotranspiration and soil water reserve" potx
Ngày tải lên :
08/08/2014, 00:22
... use of water within forest, where transpiration tend to dampen more than to amplify the variations in evaporative demand or annual variations in water availability [17, 29] Total stand transpiration ... according to leaf area development For periods of leaf area expansion and leaf fall, daily transpiration was calculated with an equation based on daily PET and on a relative LAI (LAIi/LAImax), with ... The schist (at 180 cm depth), the clayed horizons and the flat topography induce the accumulation of water Approximately, all water that penetrates the soil only gets out by evapotranspiration...
- 9
- 319
- 0
Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx
Ngày tải lên :
09/08/2014, 07:20
... BP and FC analyzed and interpreted the data LM, SL and TB made a substantial contribution to the acquisition of clinical data and the follow-up of the patients All authors read and approved the ... index ASP RA sample, taking advantage of the linkage data available at the PTPN22 locus, as previously described [32] Test for linkage and association in the TDT RA samples Linkage and association ... polymorphism The sense and antisense primers were, respectively, 5'-GATAATGTTGCTTCAACGGAATTT-3' and 5'-CCATCCCACACTTTATTTTATACT-3' The PTPN22-1858C/T transition at codon 620 eliminates a restriction...
- 8
- 342
- 0
Delivery of chemotherapeutic agents using drug-loaded irradiated tumor cells to treat murine ovarian tumors doc
Ngày tải lên :
10/08/2014, 05:21
... pGL3-basic (Promega) using the 5’ primer CGGAGATC TATGGAAGACGCCAAAAAC and the 3’ primer CGGGTTAACTTACACGGCGATCTTTCC The amplified luciferase cDNA was inserted into the BglII and HpaI sites of the ... luminescence activity on a weekly basis from the day of MOSEC/luc cells challenge Statistical analysis All data expressed as mean ± SD are representative of at least two different experiments Comparisons ... image of the tumor cells at days of incubation The numbers at the top indicate identical trials of the same experiment (B) Bar graph depicting the measured expression of luciferase in the viable...
- 12
- 166
- 0