... research’s aim is to examine the impact of ‘Peer-teaching’ on ESP teaching and learning quality, the collected data ofthe study was analyzed both quantitatively and qualitatively according to two facets: ... important since the alternative is a more instrumental peer teaching approach which often involves some form of credit or payment forthe person acting in a teaching capacity thus losing a sense ... giving and receiving feedback and evaluating their own learning. Peer learning is becoming an increasingly important part of many courses, and it is being used ina variety of contexts and...
... repair the link break, the node broadcastsan RREQ for that destination. Otherwise, the node makes a list of unreachable destinations consisting ofthe unreachableneighbor and any additional ... the performance ofthe Bypass-AODV as well as the originalAODV.(1) The routing overhead ratio is the ratio ofthe amount in bytes of control packets transmitted to the amount in bytes of data ... discoverymechanism will start. Nevertheless, the routing overhead in Bypass-AODV experiences little increase relative to AODV,as shown in Figure 13. On the other hand, increasing the speed will increase...
... database in Montpellier.3.3. Study ofa statistical modelEach physical and mechanical characteristic not being ableto explain alone cutting forces involved during machining,their combination ... during machining. In fact, it appearedthat best results were obtained fora combination of specificTable VII. Variance analysis ofthe first model including interactions between factors: elasticity ... static, allowed a very good approximation of true woodbehaviour during machining. In fact, the unique parameter“Pf,I” is able to explain almost 70% ofthe variations of cuttingforces involved...
... ExtraordinaryChambers ofthe Courts of Cambodia (ECCC) and, of course, the InternationalCriminal Court – are also examined. Thelawof the InternationalCriminal Court, contained in its primary instruments ... assist in ascertaining the elements of aiding and abetting in customary international law, the Trial Chamber engaged ina detailed analysis of a number of post-Second World War cases adjudicated ... responsibility that has no trueparallel in domestic criminal law. 11Indeed, as domestic and international avenues forinternationalcriminal adjudication proliferate, and regional and international politics...
... practitioners. International videotapes serve as a record of teaching ina par-ticular time and place, and make that teaching available for multiplereexaminations; they facilitate collaboration among ... in turn, meant that little can INTERNATIONAL COMPARATIVE RESEARCH IN EDUCATION 13grating qualitative and quantitative analysis. Several noted that the challenge of reconciling qualitative and ... SciencesNational Academy of EngineeringInstitute of MedicineNational Research Council MAKING EDUCATION STANDARDS INTERNATIONALLY COMPETITIVE viiPreface The Board on International Comparative Studies in...
... up an excellent national and international reputation in these fields. The two institutions also complement each other in terms of both staff and subject matter: their areas of research and approaches ... opportunities for graduates ofthe program may be found, for example, inthe following areas: ã macroeconomic analysis in central or commercial banks, ã official bodies (e.g. tax or finance authorities), ... who are familiar with the issues intheinternational economy. The recurring crises in financial markets, and their implications for economies in general, show how important the functioning of...
... place at the ICTY, the ICTR, and the Special Panels, and they examine, among other things, the nature ofthe bargaining that has occurred, the rationales used to justify that bargaining, the ... “ [a] gainst great odds” that the Security Coun-cil did eventually create the ICTY. e road to the creation of an international tribunal for Rwanda featured sim-ilar obstacles. Inthe span ... cre-ation ofthe ICTR. e creation ofthe ad hoc tribunals for Rwanda and the former Yugoslavia helped to restart the on-again, o -again negotiations regarding a permanent S3857.indb...
... the Ig-b gene butunnecessary forthe maintenance ofthe active chromatinstate inthe Ig-b locus. In transient transfection assays, the DNA fragmentcontaining a DHS at )2.1 kb shows no enhancingactivity ... level of the core histones and a chromatin state inthe flankingregion resistant to DNase I [1]. In this case, the forma-tion of cell type-specific DHS again does not occur in the context ofa DNase ... pro-moters and enhancers but also are likely to participate in the establishment and maintenance of an activechromatin state [18,28,29]. In addition to their pres-ence in and adjacent to active...
... (tgctctagagcggccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C-HIS1-rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga catgccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatgatgatgatgatgatgatgct tatcgtcatcgtcc). The ... GateCPUfor(ggggacaagtttgtacaaaaaagcaggcttcaccatgaagctttgcagcc ttgcagtccttgtacc); Reverse: C-HIS1rev and C-HIS2rev and Gate-HISrev (ggggaccactttgtacaagaaagctgggtcctaagatccactatgatgatgatgatgatgatgatg). The resulting PCR fragments ... substrates, and determined the Kmconstants of native CPU from plasma, recom-binant WT CPU and YQ CPU for Hip-Arg and bra-dykinin using an arginine kinase-based kinetic assay[27]. Data are presented...
... and extends thisphysiological location of DT to the lysosomal appara-tus of insensitive cells.Comparable to the endosomal degradation of inter-nalized ricin A- chain in macrophages [30], the ... Journal compilation ê 2008 FEBS 1709 Fig. 1. Kinetics ofthe appearance of DT and mDT inthe endo-lysosomal apparatus after toxin administration. (A) EN were isolated at the indicated times after ... Molecular mass markers are indicated to the left of each blot. Arrows to the right indicate the mobilities of intact (90 kDa) or truncated furin (70 kDa).T. El Hage et al. Activation and translocation...
... crystal size inthe formed plates and has a 2larger surface area. Increasing the amount of Na SO24additive to the positive electrode will not decrease the crystal size appreciably. The Na SO additive ... surfacearea and cause higher initial capacity and average capacityper cycle for both testing methods: the standard cycletesting and the ES driving pattern cycle testing. The initialand average ... leading to a lower capacitybecause ofthe smaller surface area. The additive Na SO24 in the positive electrode material can reduce the 4BScrystal size, which has a larger surface area and increasethe...
... clearly defined germination peaks. In both P. pinaster and P. radiata most ofthe treat-ments place the peaks of maximum germination betweendays 7 and 25. These peaks are sharper in P. radiata ... percentage data was transformedusing an Arc-sine Transformation, and the average ger-mination time data using the log (mean germinationtime). The Test of Tukey [40] was used to analyse the dif-ferences ... 1990 and 1992 had very low germination val-ues forthe same treatments. Forthe Temperature andTemperature + Ash treatments, germination rates nearlyalways increased as seed age decreased.Tree...
... composed of at least three main and distinct signalling pathways: the extracellular signal-regulated protein kinases, the c-Junamino-terminal kinases or stress-activated protein kinases,and the ... is an interesting target inthe context of OA for at leasttwo main reasons. First, NO and its byproducts are able toinduce the inflammatory component of OA; NO can increase the activity of ... plays a central role in OApathophysiology. Factors that regulate its synthesis and/oractivity are therefore favoured targets. Other approaches arebroader and include activating or increasing...