the apob apoa i ratio is a strong predictor of cardiovascular risk
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... proportional hazards models Variables found to be statistically significant at a 10% level in the univariate analysis were included in the multivariate model using backward elimination Different ... clinical investigation of the prognostic value of circulating Ang-2 as a biomarker in critically ill patients The results are that: critically ill patients are characterised by an excess of circulating ... a univariate analysis In a surgical population with ARDS, Ang-2 predicted death with a similar discriminatory ability as the APACHE II score [23] However, none of the aforementioned studies tested...
- 9
- 634
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... attractive subtype for patient stratification Conclusions Identification of cytogenetic abnormalities using karyotyping for prognosis and treatment of hematological malignancies has been a standard ... 3b) Discussion Karyotyping is a standard clinical practice for hematological malignancies, and the cytogenetics of the disease not only helps with diagnosis, but often provides prognostic values ... studied in early phase I and II trials [12] GSK1070916 is a selective inhibitor of AURKB/C and has demonstrated anti-proliferative characteristics in vitro and in vivo for both solid tumors as...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... attractive subtype for patient stratification Conclusions Identification of cytogenetic abnormalities using karyotyping for prognosis and treatment of hematological malignancies has been a standard ... 3b) Discussion Karyotyping is a standard clinical practice for hematological malignancies, and the cytogenetics of the disease not only helps with diagnosis, but often provides prognostic values ... studied in early phase I and II trials [12] GSK1070916 is a selective inhibitor of AURKB/C and has demonstrated anti-proliferative characteristics in vitro and in vivo for both solid tumors as...
- 10
- 665
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... which the lysine residue of the ATP binding domain is mutated to arginine, still interacted with PTI1-4 These data indicate that the kinase activity of OXI1 is not required for the interaction ... (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed in E coli and generation of the active form in stress ... HIS-OXI < HIS-PTI < HIS-OXI < HIS-PTI GST-MPK3 > < MBP 55- HIS-OXI > < HIS-OXI < HIS-PTI HIS-PTI > < HIS-OXI < HIS-PTI < MBP Fig OXI1 phosphorylation of PTI1-4 (A) In vitro kinase assay using recombinant...
- 11
- 700
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... interacts simultaneously with both CPEB and the eukaryotic initiation factor eIF4E This interaction interferes with the formation of eIF4F, a complex required for translational initiation, and therefore ... Fragment sizes (M) are indicated on the right in base pairs (bp) is confirmed by the present data which show an acceleration of meiotic maturation by CPEB antibody injection The discrepancy with regard ... subcellular localization of mammalian Rbm9 is unclear and is dependent on the isoform and the tissue examined; however, it appears to be mainly nuclear in cell lines and brain where, nevertheless, there...
- 14
- 502
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... not the b domain The distinguishing feature of members of the meiotic clade of AAA ATPases is the SRH motif, which differs from that of other AAA ATPases [24] The pair of Arg residues in the ... by these AAA ATPases Thus many AAA ATPases function as protein disassembly machines [25] ATPase activity of Vps4 is critical for disassembling the MVB sorting machinery, including the endosomal...
- 23
- 490
- 0
Cho ví dụ về một quan hệ pháp luật cụ thể,phân tích yếu tố chủ thể,khách thể và nội dung của quan hệ pháp luật đó pot
... hoàn thành việc sản xuất cu a ca i vật chất và thu được lơ i nhuận ) III.KẾT LUẬN Tóm la i, quan hệ pháp luật có vai trò to lớn việc i ̀u chỉnh các quan hệ xã hô i bản và ... đồng lao động, tho a ước lao động tập thể và các tho a thuận khác vơ i ngươ i lao động; - a m bảo an toàn lao động,vệ sinh lao động và các i ̀u kiện lao động khác - a m bảo ... xác lập,thực hiện các quyền và nghi a vụ pháp lí b.Nô i dung quan hệ pháp luật Nô i dung cu a quan hệ pháp luật bao gồm : Quyền và nghi a vụ pháp lí cu a chủ thể tham gia...
- 5
- 33,979
- 280
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... continue its alimentary habit of hematophagy The presence of anticoagulants in the salivary glands of the leech, Hirudo medicinalis, was originally discovered by Haycraft in 1884 and led to the isolation ... epitope on collagen This has significant implications for the use of saratin as a tool to inhibit platelet–collagen interactions, and may provide the basis for the therapeutic use of saratin as ... demonstrated that local administration of saratin inhibited atherosclerotic plaque thrombogenicity under shear conditions [22] The main collagen-binding site on VWF resides within the A3 domain (residues...
- 11
- 440
- 0
The leg-to-body ratio as a human aesthetic criterion pdf
... suggesting that both male and female participants were rating the images in the same manner Discussion The results of this investigation are consistent with the idea that the LBR plays a role in ... such things as the mass media In addition, some evolutionary psychological theories predict local variation in aesthetic preferences as a result of calibration to locally prevailing ranges or ... context-sensitive adaptations of the beholder? Shiwiar use of waist-to-hip ratio in assessments of female mate value Evolution and Human Behaviour, 25, 51–62 Swami, V., & Furnham, A (2006) The science of...
- 7
- 408
- 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain The MADS box is essential for DNA binding and dimerization, and ... and the MEF2 domain plays an important role in DNA binding affinity as well as an indirect role in dimerization The C-terminal portion of MEF2C is required for its transcriptional activation [13] ... Nagasawa H, Isogai A, Ishizaki H & Suzuki A (1991) Prothoracicotropic hormone of the silkworm, Bombyx mori: amino acid sequence and dimeric structure Agric Biol Chem 55, 73–86 Kawakami A, Kataoka...
- 10
- 437
- 0
Báo cáo khoa học: Inactivation of phosphorylase is a major component of the mechanism by which insulin stimulates hepatic glycogen synthesis doc
... over a wide range of activities of In view of the above findings that inactivation of phosphorylase mimics insulin stimulation of glycogen synthesis (Figs and 5), whereas inactivation of GSK-3 has ... On the basis of the present findings that inactivation of phosphorylase is essential for stimulation of glycogen synthesis by insulin and it is also a contributing factor to the activation of ... for the number of hepatocyte preparations indicated Statistical analysis was by Student’s paired t test Fig Time course of inactivation of phosphorylase a (A) and activation of glycogen synthase...
- 9
- 381
- 0
the nothing that is, a natural history of zero - robert kaplan
... karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati ... figure, as Shakespeare called it, play so crucial a role in shaping the gigantic fabric of expressions which is mathematics? Why most mathematicians give it pride of place in any list of the most important ... call up the spirit of numbers by naming them, but they remain as elusive as ever, with the will o' the wisp of zero dancing them away Follow this dance into India along the invasion route of Alexander...
- 238
- 5,165
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... nursing) A factor analysis was conducted in SPSS version 15 on job satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain ... cases two factors were identified Analysis of Variance (ANOVA) and Multivariate Analysis of Variance (MANOVA) were used to test for statistical difference in first-order job satisfaction factors ... job satisfaction factors that are statistically significant are shown in the diagram and odds ratios are presented for the bottom (1 = very unsatisfied) and top (5 = very satisfied) of the point...
- 12
- 530
- 0
Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx
... As PS and associated proteins are major targets of autoantibodies in SLE [8], cells stimulated via the P2X7 receptor may be a significant source of autoantigen in this disease An allelic variation ... and gene have the functional and positional characteristics suggestive of a role in the pathogenesis in SLE, and that the potential of the cell death mechanism aponecrosis to contribute to disease ... -20°C IL-1β was quantified by ELISA (Quantikine mouse IL-1β kit; R&D Systems, Minneapolis, MN, USA) in accordance with the manufacturer's instructions Statistical significance was measured by Student's...
- 8
- 429
- 0
Báo cáo y học: "Uric acid is a strong independent predictor of renal dysfunction in patients with rheumatoid arthritis" docx
... manuscript and participated in data acquisition VP participated in data acquisition, provided technical assistance and assisted in analysis and interpretation of data TT, HJ and IA participated ... in data acquisition PN performed the statistical analysis and assisted in manuscript preparation KMJD and RK participated in data acquisition and assisted in manuscript preparation GDK conceived ... [20] in patients with RA We have also shown that renal dysfunction in RA is associated mainly with cardiovascular risk factors and not RA-related factors such as disease activity, severity or therapy...
- 8
- 327
- 1
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
... 2C), an increase in membrane ion leakage of Agroinfiltrated leaves (Additional file 2B) and a significant increase in lipid peroxidation (Figure 2D) at five days after infiltration The latter was ... contributions JAQA carried out the experiments, the statistical analysis of the data and drafted the manuscript MTBR and PABR assisted directly the qRT-PCR assays and the caspase 3-like activity experiment.GLR ... M, Akiyama K, Taji T, YamaguchiShinozaki K, Carninci P, Kawai J, Hayashizaki Y, Shinozaki K: Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and high-salinity...
- 14
- 254
- 0
báo cáo khoa học: " Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity" docx
... Groups III and IV shared motifs in the NTR and subgroups Ia, Ib and Ic had no characteristic motifs in this region Based on motif distribution within each CTR, the domain was divided in two regions: ... that the capability of H1WCT of mimicking HAHB4 and H4WCT insensitivity to ethylene is the product of an inhibitory mechanism important in this pathway, especially considering that HAHB4 has an ... the Kruskal-Wallis oneway analysis of variance by ranks and then the different lines were classified in groups according to pairwise comparisons with a p-value of 0,05 (Table 2) Additional material...
- 19
- 355
- 0
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
... exhibit any anti-HIV1 activity The low antiviral activities of P7 peptide indicated that the C-terminal cytoplasmic tail in P7 did not contribute to the antiviral activities Previous research ... T20 and P5 exhibit antiviral activities by different mechanism, and that P5 specific activity is calcium dependent P5 inhibits replication of T20-resistant HIV-1 strains Since there were significant ... 10 IC 50 (nM) 10 10 10 10 Figure Inhibition of replication of T20-resistant HIV-1 strains Inhibition of replication of T20-resistant HIV-1 strains Inhibition of the replication of two T20-sensitive...
- 12
- 304
- 0
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx
... T-AGCCGTGTGCTATGTGAAAGATGGCAG-GCTTAAAAAAT human TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT ... TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGGTTCAGC-AGACACTCTGGGTGATCTTTATTGAGTGAT ... dataset, is a radical extension (of an order of magnitude) of similar conserved elements, indicating a significant quantitative difference There is also a qualitative difference, however, because...
- 19
- 510
- 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... additional data are available with the online version of this paper Additional data file is a table listing the G1/S associated mRNAs predicted to be targets of miR-17-5p Additional data file is a figure ... standard deviations away from what was seen for random sampling of similar sized sets of targets The complete list of G1/S-phase related predictions is detailed in Additional data file This analysis ... components An interactive version of this figure where literature support and gene/protein information can be viewed through IPA is available [24] Additional data file is table listing all primers...
- 14
- 331
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25