the amount secured by the own shares shall be credited to this account with a debit to any of the available reserve accounts or to account 129

Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

Ngày tải lên : 19/06/2014, 08:20
... reduce cortical inhibition are therefore appealing for augmenting motor learning in behavioral therapies [38-40] Here we present data supporting the idea that depending on the nature of the training ... promote restoration of movement control A limitation of the present study design was the lack of power to conduct a multi-factorial analysis that includes all the data (i.e., agonist and antagonist ... relating to agonist-antagonist muscle pairs A single suprathreshold pulse of Transcranial Magnetic Stimulation (TMS) over the hand area of M1 results in a balance of inhibitory and excitatory processes...
  • 8
  • 432
  • 0
Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Ngày tải lên : 07/08/2014, 06:20
... restricting the covering relation of P to two adjacent ranks be regular in the graph theoretic sense.) For example, both the subsets of a set and the subspaces of a vector space, ordered by inclusion, are ... finite, there are many counting problems associated with fundamental concepts of linear algebra; for example, how many subspaces of dimension k are there in the vector space GF(q)n ? The answer is often ... versions of λ tends to and also that the theorems for either version of λ imply the theorems for the other version Since the the electronic journal of combinatorics (1997), #R3 ratio of the two...
  • 8
  • 421
  • 0
Báo cáo y học: "gA retroperitoneal abscess caused by Haemophilus parainfluenza after endoscopic retrograde cholangiopancreatography and open cholecystectomy with a common bile duct exploration: a case report" ppt

Báo cáo y học: "gA retroperitoneal abscess caused by Haemophilus parainfluenza after endoscopic retrograde cholangiopancreatography and open cholecystectomy with a common bile duct exploration: a case report" ppt

Ngày tải lên : 11/08/2014, 12:20
... these abscesses are colonized by gastrointestinal tract flora [5] H parainfluenza is a normal inhabitant of the human respiratory tract and its route of translocation into the gastrointestinal tract ... The stone was assumed to have been present in the CBD for many years since it was significantly large The possibility of it being a primary CBD stone or a stone that was passed into the CBD years ... intact at operation It is well understood that H parainfluenza is a common inhabitant of the mucosal surfaces of the human upper respiratory tract [4] There is a possibility that the patient may...
  • 3
  • 242
  • 0
Default Risk Cannot Explain the Muni Puzzle: Evidence from Municipal Bonds That Are Secured by U.S. Treasury Obligations ppt

Default Risk Cannot Explain the Muni Puzzle: Evidence from Municipal Bonds That Are Secured by U.S. Treasury Obligations ppt

Ngày tải lên : 15/03/2014, 03:20
... January to August In panel C summary statistics are presented for the entire sample State corporate (personal) tax is an average of the highest state corporate (personal) tax rates in the state ... yields The source of data for nearly all prior research examining tax-exempt and taxable yields is Salomon Brothers’ Analytical Record of Yields and Yield Spreads At the beginning of each month, Salomon ... readily available only at month end.13 All of the bonds are rated AAA by Standard & Poor’s or Aaa by Moody’s investors service The rating agencies check that proper procedures are used to ensure the...
  • 28
  • 591
  • 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... bottom of the inhibitor [6] In the process, the structure of the protease appears to be deformed by being ‘crushed’ against the bottom of the inhibitor [7] In particular, this deformation of the ... Instead, the major mechanism of GAG enhancement appears to be allosteric and uses conformational activation of the serpin Heparin cofactor II possesses a unique amino-terminal extension that contains ... of AT with and without the heparin pentasaccharide bound, heparin cofactor II and cleaved protein C inhibitor are shown as indicated In all of the structures, the A b-sheet is shown in red, the...
  • 10
  • 668
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... atoms of 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are ... a profound effect on the kinetics of the rearrangement of the ‘open’ and ‘closed’ forms of the ligand loop [19] Therefore, conformer A may be considered as the open form, albeit with the axial ... leads to the visualization of two conformers On comparing the main-chain torsion angles and coordinates of the two conformers it is apparent that conformer B has almost identical geometry and coordi2445...
  • 15
  • 509
  • 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx

Ngày tải lên : 08/03/2014, 16:20
... smaller peaks (Fig 1B), as observed by absorbance detection at 214 nm Simultaneously, the spectrum of each eluting peak was recorded by a photodiode array detector The chromatogram recorded at ... it may be inferred that b-phycocyanin is the main target of UV-B radiation, and that this component is essential for the formation of all subcomplexes However, the disappearance of a peak at 214 ... X-ray crystallography has shown that the hexamers (a6 b6) are disk shaped, formed by face -to- face assembly of trimers Rods are formed by face -to- face assembly of these disks [26] Treatment of phycobilisomes...
  • 9
  • 477
  • 0
Báo cáo khoa học: A short proregion of trialysin, a pore-forming protein of Triatoma infestans salivary glands, controls activity by folding the N-terminal lytic motif pdf

Báo cáo khoa học: A short proregion of trialysin, a pore-forming protein of Triatoma infestans salivary glands, controls activity by folding the N-terminal lytic motif pdf

Ngày tải lên : 16/03/2014, 06:20
... (5¢-CCATATGAAGAAAGGAGCAGC-3¢) and Bam-LYS30 reverse (5¢-CGGGATCCTTAATCAATTTCAACTTC ATC-3¢), and the protrialysin cDNA cloned in pGEM-T Easy (Promega, Madison, WI, USA) as template [9] in order to ... Morita A, Isawa H, Orito Y, Iwanaga S, Chinzei Y & Yuda M (2006) Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin, from salivary glands of the ... Anticoagulant activity of Triatoma infestans and Panstrongylus megistus saliva (Hemiptera ⁄ Triatominae) Acta Trop 61, 255–261 Amino R, Tanaka AS & Schenkman S (2001) Triapsin, an unusual activatable...
  • 9
  • 452
  • 0
The Harvard Classics Volume 38, by Various Copyright laws are changing all over the world. Be sure to check the copyright laws for your country before downloading or redistributing this pdf

The Harvard Classics Volume 38, by Various Copyright laws are changing all over the world. Be sure to check the copyright laws for your country before downloading or redistributing this pdf

Ngày tải lên : 22/03/2014, 23:20
... army to Turin, to recover the towns and castles that had been taken by the Marquis du Guast, Lieutenant-General of the Emperor M the Constable, then Grand Master, was Lieutenant-General of the army, ... attendants, and externals cooperate." THE OATH OF HIPPOCRATES I swear by Apollo the physician and AEsculapius, and Health, and All-heal, and all the gods and goddesses, that, according to my ability and ... frog; and all the company laughed at the skill and strength of the little fellow The great Dativo was furious to have been thus thrown to earth by so small a man: he rose again in a rage, and would...
  • 1.5K
  • 611
  • 0
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt

Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt

Ngày tải lên : 23/03/2014, 21:20
... more sensitive to acetate at pH 4.5 [2] Another study reported that Azr1p, a plasma membrane transporter of the major facilitator superfamily, also confers acetate resistance [12] We therefore ... Viegas, C .A & Correia, I (2000) Expression of the AZR1 gene (ORF YGR224w), encoding a plasma membrane transporter of the major facilitator superfamily, is required for adaptation to acetic acid and ... resistance to C3)8 aliphatic carboxylic acids and to sorbate [2,6], is actually somewhat detrimental for resistance to acetate These results appeared to contradict our previous findings of a decreased...
  • 7
  • 391
  • 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx

Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx

Ngày tải lên : 24/03/2014, 00:21
... ortholog of Caenorhabditis elegans (AhR-1C.E.), neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and ... prediction and the size of the ligand all point to FixL as a more suitable candidate Our model, although based on low sequence similarity, is capable of explaining all known experimental and theoretical ... interaction and docking calculations to more accurately de®ne the orientation of the ligand in the binding cavity ACKNOWLEDGEMENTS The ®nancial support by the Italian CNR (grant no 98.03245.ST74) and the...
  • 6
  • 569
  • 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Ngày tải lên : 31/03/2014, 09:20
... Statistical analysis The organization and the exon-intron boundaries of the human thromboxane (TX) A2 receptor (TP) gene and the theoretical range of putative TP mRNA transcripts are 4062 A T ... intrarenal vascular tissue decreasing glomerular filtration rates [29], stimulation of apoptosis of immature thymocytes [30] TXA2 has been implicated as a mediator of a number of vascular disorders ... Kinase reporter vectors and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation, Madison, WI, USA Taq DNA polymerase, T4 DNA ligase and calf intestinal alkaline phosphatase...
  • 16
  • 321
  • 0
Báo cáo sinh học: " Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

Báo cáo sinh học: " Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

Ngày tải lên : 18/06/2014, 22:20
... (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') and +/- (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') ... (5'-TACAGGCATAACGGTTCCGTAGTGA) or a CREB consensus binding site (5'-AGAGATTGCCTGACGTCAGAGAGCTAG) Also indicated is the migration of the radiolabeled probe without the addition of nuclear extract ... their natural array Indeed, c-Myb is known to function in a combinatorial manner with other transcription factors and co-activators to activate target gene expression [14] Studies were performed...
  • 10
  • 410
  • 0
báo cáo hóa học:" The integrated care pathway reduced the number of hospital days by half: a prospective comparative study of patients with acute hip fracture" doc

báo cáo hóa học:" The integrated care pathway reduced the number of hospital days by half: a prospective comparative study of patients with acute hip fracture" doc

Ngày tải lên : 20/06/2014, 00:20
... addition to the patient motivation, the care of patients with a hip fracture requires a team approach in which the co-ordination between the various aspects of care is important Integrated care ... may start a positive chain reaction that can be kept going An example is the earliest first ambulation that was planned either on the day of surgery or the next morning Thus, the aim was to achieve ... only the beginning of the rehabilitation process and it is important to facilitate a healthy transition process In contrast to the care of younger patients, the care of elderly patients is more...
  • 7
  • 305
  • 0
báo cáo hóa học:" Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

báo cáo hóa học:" Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR" doc

Ngày tải lên : 20/06/2014, 04:20
... (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') and +/- (5'-GCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTTTCAAGGCCACTGCCAGCAGATTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGAC-3') ... (5'-TACAGGCATAACGGTTCCGTAGTGA) or a CREB consensus binding site (5'-AGAGATTGCCTGACGTCAGAGAGCTAG) Also indicated is the migration of the radiolabeled probe without the addition of nuclear extract ... their natural array Indeed, c-Myb is known to function in a combinatorial manner with other transcription factors and co-activators to activate target gene expression [14] Studies were performed...
  • 10
  • 254
  • 0
The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx

Ngày tải lên : 28/06/2014, 19:20
... exists, made its appearance; that the fourth day was signalised by the apparition of the sun, the stars, the moon, and the planets; that, on the fifth day, aquatic animals originated within the waters; ... He may have been actuated by malice It has constantly happened that even an accurate man has declared that a thing has happened in this, that, or the other way, when a careful analysis of the ... titles of the principal groups of which are placed upon the accompanying diagram Each of these groups represents a number of beds of sand, of stone, of clay, of slate, and of various other materials...
  • 330
  • 324
  • 0
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot

Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot

Ngày tải lên : 10/08/2014, 09:21
... echocardiography 2D transthoracic and /or transesophageal echocardiography was also performed for independent clinical assessment of AS All images were analyzed offline on semi-automatic MASS Plus and ... require a more considered approach First off, AVR itself does not restore the transvalvular gradient to normal Despite the advent of increasingly lower profile aortic valves, to include the Toronto ... R01HL72317 for which RWWB is an investigator We are grateful for the conversations over the years with Dr Blase A Carabello, Nathaniel Reichek and thankful for the support of Dr George Magovern, Jr and...
  • 8
  • 332
  • 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Ngày tải lên : 11/08/2014, 08:22
... by this finding, as there are many promising anti-inflammatory and anti-bacterial ethnopharmacological agents that have not been adequately studied in the context of diseases that are atypical ... site of infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse ... an antiinflammatory agent [11] Recent reports indicate that this natural product is an inhibitor of NFκB activity [12,13] The overall goal of this study was to characterize the effect of this...
  • 5
  • 306
  • 0
báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

báo cáo khoa học: " Review of "The Globalisation Of Addiction: A Study In Poverty Of The Spirit" by Bruce K. Alexander Harry G Levine" pot

Ngày tải lên : 11/08/2014, 18:20
... causes great harm to others, and "can reach an unrelenting, hellish intensity and may have fatal consequences." The Globalisation of Addiction is about all forms of harmful addictions – the relatively ... familiar ways about "addiction" – though of course without using that word And he does the same with the life of James M Barrie, the talented and extremely odd author of Peter Pan In all these cases ... not materially poor Neither food, nor shelter, nor the attainment of wealth can restore them to well-being Only psychosocial integration itself can that In contrast to material poverty, dislocation...
  • 4
  • 220
  • 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Ngày tải lên : 12/08/2014, 18:20
... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing /the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References ... methicillin-resistant Staphlococcus aureus IN s in vitro [6] Moreover the flow of water enhances the antiseptic effects of this system by washing away bacterial contamination and organic material, which...
  • 2
  • 450
  • 0