the amount of the costs shall be debited to this account with a credit to accounts in subgroup 57
Báo cáo y học: " And the second shall be first" ppsx
Ngày tải lên :
14/08/2014, 17:22
... failure of the structure to explain what was already known about this type of protein is beyond me In an era when experimental details are relegated to ‘Supplemental material’, especially in the vanity ... unless they felt the need to beat their competitors and to have their work published in a journal with as high a profile as possible I think that feeling is often self-defeating, as it clearly was ... stating where the papers were published is a surrogate for actually having read them I’m ashamed to say I’ve done that myself Does being the first into print mean more than publishing the best...
- 3
- 209
- 0
CAN THE EFFECT OF GRAMMATICAL CLASS BE REDUCED TO DIFFERENCES IN IMAGEABILITY
Ngày tải lên :
09/10/2015, 11:06
... study with nine aphasic participants Comparison data were obtained from non-brain damaged participants As healthy participants often obtain naming accuracy at ceiling, the dependent variables of the ... grammatical class effects in the performance of two aphasic participants across a range of tasks A grammatical class effect refers to the partiality of retrieving words from a certain grammatical ... operate at the stage of word form retrieval and to test the claim that the effects of imageability and grammatical class in aphasic word production are independent of each other To achieve these...
- 159
- 673
- 0
A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt
Ngày tải lên :
05/03/2014, 10:20
... complement pathway 55 The normal flora of the intestinal tract of the breastfed infant, as well as the offspring of all other mammalian species studied until weaning, is bifidobacterium or lactobacillus.54 ... recommended as an adjunct to therapy with INH in adults and adolescents and in breastfeeding infants of mothers receiving INH INH has a maternal half-life of about six hours Food decreases the absorption ... following explanations:73,74 HCV levels are too low in colostrum to infect the infant Maternal and Child Health Technical Information Bulletin A small amount of HCV may be inactivated in the infant’s...
- 40
- 816
- 1
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
Ngày tải lên :
23/03/2014, 20:22
... Phosphatase-treated nuclear extracts were assayed for their DNA-binding capacity in standard EMSA UV crosslinking of DNA–protein adduct The EMSA reaction was carried out using ng labelled Jun)25 and ... acrylamide) and analysed by autoradiography changes of · binding buffer over a period of 30 and autoradiographed Affinity purification of the factor(s) interacting with the )148 to )124 region of ... in an active conformation RLjunRP is an 40 kDa protein that forms an 80-kDa protein–DNA adduct To assess approximate molecular mass of the factors interacting with the )148 to )124 region of...
- 9
- 449
- 0
Báo cáo " Balance of rice for the Mekong Delta - Viet Nam to 2050 in terms of industrialization and climate change '''' doc
Ngày tải lên :
24/03/2014, 01:21
... agricultural land in association with the overall planning of land use in other fields toward developing harmoniously agriculture and According to the original script of the model, rural development with ... consider the factors affecting the yield as well as the distribution of the rice area Factors affecting productivity are basic inputs, indirectly affect to the total rice output and rice supply variable ... offset and expanded Climate change has caused disasters in Viet However, the reclamation and restoration land Nam increasing in number, intensity and extent of almost disappeared, while climate change...
- 7
- 527
- 2
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot
Ngày tải lên :
29/03/2014, 09:20
... membrane-spanning region (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic GC domain [1,7] In the absence of ... concentrations are associated with significant changes in blood pressure [6] The GC -A receptor consists of an extracellular ligand-binding domain of approximately 441 amino acids (aa), a short membrane-spanning ... approximately nine-fold in ANP-treated samples, indicating an increased amount of peptide (Fig 5) Taken together, the results from multiple reaction monitoring revealed that the amount of partially...
- 14
- 313
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
Ngày tải lên :
18/06/2014, 16:20
... conditions of the intended clinical use of the assay, since blood from Ab-01 treated subjects (containing Ab-01) would have to placed in a queue in a laboratory prior to addition of rhIL21 The experiments ... would not have been practical in the setting of a clinical study, the final assay protocol included a two hour incubation period in the presence or absence of Ab-01 This protocol mimicked the conditions ... fascicularis; Charles River BRF, Inc, Houston, TX) weighing to kg were singly or pair housed and cared for according to the American Association for Accreditation of Laboratory Animal Care guidelines The...
- 13
- 528
- 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
Ngày tải lên :
18/06/2014, 19:20
... compared with the hypothesised correlations The variance explained (the percent of the total measured variance in the SF-8 items explained by the two principal components) was also analysed The ... References 10 11 Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf.or.jp/news/baseline/Baseline.pdf] ... Mental health, social functioning, and disability in postwar Afghanistan JAMA 2004, 292(5) :575 -584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes...
- 10
- 647
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... cortical inhibition are therefore appealing for augmenting motor learning in behavioral therapies [38-40] Here we present data supporting the idea that depending on the nature of the training and ... motor training In fact such protocols aim to augment the sustained changes in synaptic efficacy brought about through training, by altering motor cortex excitability during or before training ... an early phase of learning, and involve release of activation to antagonist muscles These findings may have implications for training paradigms in the neurorehabilitation field Page of 8 10 11...
- 8
- 432
- 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
Ngày tải lên :
20/06/2014, 01:20
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E ... for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with the Thermal Cycler ... denaturing gel, transferred to a PVDF sheet, and reacted with the antibody to UL7 (first panel) The same membrane was reacted with the antibosy to the flag again (second panel), to the βactin...
- 13
- 463
- 0
Charade of the Debt Crisis From Buffoonery to Tragedy in the Debt Folly and Euro Farceby pptx
Ngày tải lên :
27/06/2014, 23:20
... boatloads of money into sprucing up the goods and hawking the products to a global marketplace To an increasing degree, the story is similar in the banking industry For instance, the greatest advances ... of training programs run by operators in the private sector In this light, a plain sample lay in a workshop catering to the newly jobless workers in the defunct banks in order to train the participants ... examples are legion and the evidence rampant To begin with a counterexample, a mindful person will note that a checking account is apt to be more costly to maintain at a large bank than a smallish...
- 36
- 572
- 0
Báo cáo lâm nghiệp: "The route of the pollen tube from stigma to ovule in Populus nigra : a new look" docx
Ngày tải lên :
09/08/2014, 06:22
... the pollen tube in the stigmatic tissue has been established by the classical ABF method Complementary and original observations have been achieved in the ovary cavity by a scanning electron ... Proc of the XVllth Session of the international Poplar commission, Ottawa, Canada, 25-30 ON T m AM H l D., 1976 Inter,!ectional incompatibility in Populus PhD thesis, Australian Nation3 Univ Canberra, ... lobes Pollen grain adhesion, hydration and germination on a P nigra stigmatic surface is observed in figure Pollen tubes penetrate the stigma, grow through the stigmatic lobes and join together...
- 6
- 310
- 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf
Ngày tải lên :
11/08/2014, 17:21
... involved in drafting the manuscript and in the review of the literature SH participated in the surgery and was involved in the clinical follow-up JR participated in the surgery, was involved in the ... by the Editor -in- Chief of this journal Author’s contributions TH was involved in drafting the manuscript and in the review of the literature and in performing the clinical follow-up HG was involved ... longitudinal splines, over a 16-Foley catheter The procedure included insertion of a suprapubic cystostomy The operation time was 144 minutes for the first patient Because of the complicated preparation,...
- 4
- 292
- 0
Rise of the machines moving from hype to reality in the burgeoning market for machine to machine communication
Ngày tải lên :
04/12/2015, 00:11
... status to the cloud, while custom applications or analytics can be performed at a higher aggregate level “Pushing data to the cloud got us out of a mindset that saw this as a point -to- point integration ... technology have steadily been falling into place So what has changed to mark this transition, and what will drive take-up in the next decade? Marc Sauter, the head of global M2M business development at ... operators need to continually develop their own business models and customer offerings Machine -to- machine and the Internet of things in 2012: Big on hype, addressable market potential and pain,...
- 22
- 360
- 0
Báo cáo y học: "The self-reported Montgomery-Åsberg depression rating scale is a useful evaluative tool in major depressive disorder" potx
Ngày tải lên :
11/08/2014, 17:20
... performed at baseline and at weeks 1, and after start of treatment Sociodemographics and clinical data were collected at baseline, and the investigators administered the MADRS, the Clinical Global Impression ... Construct validity The results of the factor analysis confirmed the unidimensionality of the MADRS-S: each item contributed to the first factor axis with a factor loading of at least 0.50, explaining ... reliability of the MADRS-S was satisfactory, with a Cronbach's alpha of 0.84, allowing group comparisons The deletion of any of the items would not increase the internal consistency of the total...
- 6
- 519
- 0
dicks - the forex edge; uncover the secret scams and tricks to profit in the world's largest financial market (2012)
Ngày tải lên :
04/11/2014, 05:24
... me to the games that were being initiated against me, and I want to share them with you in the coming chapters of this book The unfortunate reality is that I am and have already begun to be blacklisted ... is okay to read the postings—just take what you read with a grain of salt Accounting Ask how your money will be managed and in what type of account, as well as which kind of accounting statements ... NFA, which is a selfregulatory organization authorized by Congress The NFA maintains a database of futures-related disciplinary information that investors can access by calling the Disciplinary...
- 401
- 489
- 0
The factors affecting customers loyalty to supermarkets in ho chi minh city
Ngày tải lên :
24/09/2015, 16:18
... loyalty Griffin (2002) assumed that gaining more loyalty brings a number of competitive advantages to a company, as stated below: Loyal customers actively choose to purchase again and again ... Cronbach's Alpha scale, exploratory factor analysis (EFA) and regression analysis Using Cronbach's Alpha aims to remove inappropriate variables Crobach's Alpha coefficients of factors must be greater ... marketing tool that bonds customers and retail stores Cant and Toit (2012) agreed with the viewpoint that loyalty card programs are a marketing tool created to increase customer loyalty towards...
- 111
- 765
- 2
Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf
Ngày tải lên :
19/02/2014, 18:20
... free amino acids The quantities of [14C]aminoacyl-tRNA (made in the pathway from 14C-labeled amino acids), [3H]aminoacyl-tRNA, 14 C- and 3H-labeled protein were measured The 3H in protein was insignificant, ... insignificant, showing that the aminoacyltRNA made from amino acids and tRNA did not mix with the introduced aminoacyl-tRNA; i.e there was perfect channeling from free amino acids to protein In this ... of the cell That is, intermediates just made in a pathway are not part of the same pool as are identical molecules within the cell Intermediates produced within the pathway are ‘channeled’ to the...
- 10
- 438
- 0
báo cáo hóa học:" Research Article Existence and Uniqueness of Positive Solutions for Discrete Fourth-Order Lidstone Problem with a Parameter" doc
Ngày tải lên :
21/06/2014, 18:20
... supported financially by the National Natural Science Foundation of China 10971046 , the Natural Science Foundation of Shandong Province ZR2009AM004 , and the Youth Science Foundation of Shanxi Province ... completes the proof of the 16 Advances in Difference Equations Remark 3.4 In Theorem 3.1, the more general conditions are imposed on the nonlinear term than Theorem 1.1 In particular, in Theorem ... Furthermore, such a solution uλ satisfies the properties (i)–(iii) stated in Theorem 1.1 The aim of this work is to relax the assumptions A1 and B1 on the nonlinear term, without demanding the...
- 18
- 282
- 0
Báo cáo hóa học: " Research Article Comparison of OQPSK and CPM for Communications at 60 GHz with a Nonideal Front End" docx
Ngày tải lên :
22/06/2014, 19:20
... 120◦ beam width and is located in the center of the room The remote station has an omni-directional antenna with 60◦ beam width and is placed at the edge of the room The corresponding Saleh-Valenzuela ... fluctuation is larger than the dynamic range of the ADC Without going into detail, we mention that there is always an optimal clipping level for a given NOB As the clipping level is increased, the ... Offset-QPSK, a variant of QPSK digital modulation, is characterized by a half symbol period delay between the data mapped on the quadrature (Q) branch and the one mapped on the inphase (I) branch This...
- 14
- 350
- 0