the ageing of a great player tom watson s play in the us open from 1980 1993
The essential qualities of a team player 1 pptx
... important internal partnerships? • What traits of an internal partnership are most important to achieving results? • What are the primary obstacles to effective internal partnerships? • What are the ... players • Disciplined: Where there s a will, there s a win 17 Essential Qualities (cont.) • Enlarging: Adding value to teammates is invaluable • Enthusiastic: Your heart is the source of energy ... issues related to achieving profitable CRA results? Survey – Most Important Internal Partnerships? NCC CDC/CDA Specialty Lending Mortgage origination Retail mgmt Comm/Investment RE Small business...
- 6
- 388
- 0
The essential qualities of a team player 2 potx
... employers Public service providers Governmental entities GSEs Real estate professionals Trade associations Collaboration in Practice • • • • • Specialty lending goals/business plans Homeownership ... together agreeably Collaboration is working together aggressively.” External Partners in the neighborhood!” • • • • • • • • • Housing counselors Housing related non profits Small businesses Other employers ... Lack of communication • Lack of appropriate follow up • Silos – getting all lines of business to work together simultaneously • Budget • Lack of support staff Survey – Key Issues Related to Achieving...
- 6
- 460
- 0
The essential qualities of a team player 3 pot
... Audience referral sources (traditional & non-traditional) Materials designed for use by CRA, CDA & mortgage Objectives provide industry updates, discuss other topics of interest, stimulate ... discuss other topics of interest, stimulate followup “You hit home runs not by chance, but by preparation.” -Roger Maris ...
- 5
- 442
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... conformational spaces of a and b-amino acids, grid searches were performed and the generated structures were superimposed with canonical conformations of a- amino acids The atoms used in the rmsd calculation ... ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried out at 22 ... because [Pro9]SP is as potent as SP Ca monomethylation of Gly9 drastically increases the affinity for the NK-1m binding site of [Ala9]SP, supporting the formation of a new stabilizing interaction...
- 11
- 860
- 0
Danger! A True History of a Great City''''s Wiles and Temptations pot
... of coffee are in one place, chests of tea in another, hogsheads of molasses and sugar, and various other kinds of goods are distributed all over the place Some boys are playing "tag," and they ... too, for the safe-keeping of stolen articles of all kinds An instance of the daring and ingenuity of these "wharf rats," as well as an illustration of some of their methods, is furnished in the following: ... guess what had become of him In some portions of the town, garrets are made use of as club-rooms and places of rendezvous, and are exceedingly well arranged These places are used as storehouses,...
- 141
- 329
- 0
Báo cáo khoa học: Odorant binding protein has the biochemical properties of a scavenger for 4-hydroxy-2-nonenal in mammalian nasal mucosa doc
... as it passes through nasal turbinates, resulting in a general decrease in bites This, in turn, would cause a reduction in vectormediated parasitosis and infectious diseases Evaluation of the third ... with a rabbit serum raised against HNE–protein adducts Ligandbinding tests showing the functionality of the same HNE-treated porcine (B) and bovine (C) OBPs as in the immunostaining The plots show ... tree, nasal mucosa and sweat glands [25] Human tear lipocalin has significant sequence homology with the human forms of OBP and, at least in humans, partially shares a similar tissue distribution...
- 12
- 386
- 0
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt
... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, a blood meal initiates the strong synthesis of ACE in the testes, ... every isoform displays a transmembrane region Knowing whether all isoforms in Astacus are membrane bound proteins is interesting because it raises questions about both the evolution of ACE in different ... Immunohistochemistry: (D) In the testis, staining is present on the membranes of mature spermatozoids (spz), whereas spermatogonia are unstained (E, F) In the cross section of vas deferens, staining...
- 12
- 486
- 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx
... number of Cách diễn đạt mang tính tương đối trang trọng Sau A large amount of a great deal of danh từ không đếm Ví dụ: * She has spent a great deal of time in Europe Sau A large number of trước danh ... Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không đếm danh từ s nhiều Ví dụ: * There is plenty of time * Plenty of shops accept credit cards A large amount of, a great deal of , a large ... most, mặt ngữ pháp không hẳn giống Theo sau từ a lot, lots, plenty, a large amount a great deal giới từ Of Ví dụ: * Plenty of shops open on Sunday mornings (không phải là: Plenty shops …) * Many...
- 6
- 1,742
- 11
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx
... indicate their answers either verbally or using a hand scale (0 = closed fist, = all fingers open) The responses use a combination of high score = best status and low score = best status as a mechanism ... Palliative Care Association of South Africa Assessing construct validity ideally involves comparing a measure with a different measure of the same construct that has previously been validated in the ... 1) Participating Sites The validation was undertaken in palliative care sites, in South Africa and in Uganda, based in rural, periurban and urban areas, including homecare, day care and inpatient...
- 9
- 477
- 0
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx
... All statistical analyses were conducted using SPSS 11.0 software (SPSS, Inc., Chicago, IL) We applied separate × (cognitive task × sensory condition) repeated measures analyses of variance (ANOVA) ... algorithm uses the peakto-peak amplitude (range) of COP AP displacement to estimate the amount of postural sway in the AP plane Scores are calculated as the angular difference, expressed as a percentage, ... values and ES to detect a change in postural control associated with the performance of a secondary cognitive task The ability to stand as still as possible was evaluated under single task (standing...
- 7
- 603
- 0
báo cáo hóa học:" Development of a patient reported outcome measure for fatigue in Motor Neurone Disease: The Neurological Fatigue Index (NFI-MND)." pot
... Summary Analysis figures for Rasch analyses of the NFI:MND Item Residual Analysis Name 1.Energy Initial Energy Final Weakness Initial Weakness Final Summary Initial Summary Final Ideal Values # of ... the simple duality of the ‘Weakness’ and ‘Energy’ subscales will also assist clinicians in assessing what patients mean when they describe feelings of fatigue As such 16 the NFI-MND fatigue scale ... this manner may have caused the sample to be skewed toward patients who were at early stages of the disease rather than those nearing the end stage of the disease, although ALSFRS-R scores suggested...
- 31
- 318
- 0
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of. potx
... number of Cách diễn đạt mang tính tương đối trang trọng Sau A large amount of a great deal of danh từ không đếm Ví dụ: * She has spent a great deal of time in Europe Sau A large number of trước danh ... Plenty of mang ngh a : “đủ nhiều n a , theo sau danh từ không đếm danh từ s nhiều Ví * * dụ: There Plenty is of shops plenty accept of time credit cards A large amount of, a great deal of , a large ... mang ngh a tương tự như: much, many most, mặt ngữ pháp không hẳn giống Theo sau từ a lot, lots, plenty, a large amount a great deal giới từ Of Ví dụ: * Plenty of shops open on Sunday mornings...
- 5
- 556
- 0
Ôn thi TN 2011 - Chủ đề : many, much, a few, few, a little, little , most, most of, a number of, a great deal of…. pps
... childhood A a large number of B a great deal of C a few D many 28) Peter has spent time and money on stamp collecting A a few of B many of C a great deal of D a large number of 29) I have got ... 2011 A so much B a few C so many D many 26) my students are familiar with this kind of school activities A Most B Most of C A few D Few 27) He had spent time writing an essay about his childhood ... there water in the glass? A any B some C many D lots of 35) Peter doesn’t want to A something B anything C nothing D everything 36) Can you speak French? – Yes, A a few B few C a little...
- 3
- 675
- 3
Báo cáo lâm nghiệp: "The reproductive success of a Quercus petraea × Q. robur F1-hybrid in back-crossing situations" potx
... lamina from the lamina base to the widest point, number of lobes, number of intercalary veins, basal shape of the lamina and abaxial lamina pubescence) were assessed on five fully expanded and ... hybridization might also be a result of different sampling strategies, sample sizes and data analysed in different ways, which makes it difficult to generalise from and compare studies Results from a recent ... species as a clear indication of true speciation Also, the facts that the two species occupy different edaphic habitats in Denmark, and that a nationwide allozyme study of 26 Danish populations has...
- 9
- 304
- 0
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx
... investigate the relation of the S equi subsp zooepidemicus strains the 43 isolates and the six previously Fig Typical fragments of the PCR amplified 1 6S rRNA gene of the S equi subsp zooepidemicus strains; ... diseased pigs and monkeys in Indonesia J Clin Microbiol 1996, 34, 22012204 16 Stableforth AW Streptococcal disease In: Stableforth AW, Galloway IA (eds.) Infectious Disease of Animals Disease ... two isolates from Java from diseased pigs These Persistent occurrence of Streptococcus equi subsp zooepidemicus in the pig and monkey in Indonesia results indicated that the mucoid S equi subsp...
- 3
- 314
- 0
báo cáo khoa học: " The elicitation of a systemic resistance by Pseudomonas putida BTP1 in tomato involves the stimulation of two lipoxygenase isoforms" potx
... 1(CATGCCATGGGTCACCACCACCACCACGCTATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACAC TATTTGGAAC) - primer (CATGCCATGGCAGC TATAAGTGAAAATTTGGTCAAAGTTGTG) and primer (CCGCTCGAGTTATATCGATACACTATTT GGAAC) - primer ... the TomLoxC cDNA, total RNA from leaves of tomato treated with Bacillus subtilis M4 was used TomLoxF cDNA was first obtained from total RNA of methyljasmonate-treated tomato leaves Firststrand ... AtLOX3, NALOX3, and StLOXH3, all similarly involved in JA biosynthesis, are closely related On the basis of these similarities, it was suggested that TomLOXD possesses a linolenate-consuming lipoxygenase...
- 15
- 661
- 0
Báo cáo y học: " Assessing the efficacy of a modified assertive community-based treatment programme in a developing country" potx
... data were entered into a single, electronic database Statistical Analysis was done with Statistica version software (Statsoft, Inc 2009) As some of the data was descriptive in nature, results ... visits The team was based at Stikland Hospital This held both advantages and disadvantages On the one hand, the team was able to draw from the various resources in the hospital setting to strengthen ... assessments of new patients 250 Workstyle Key workers act as care coordinator bur caseloads are shared Individual caseloads Site of most visits >50% contacts are home visits Office based Engagement...
- 8
- 310
- 0
báo cáo khoa học: " Impact: a case study examining the closure of a large urban fixed site needle exchange in Canada" ppt
... vulnerable population continues to be at increased risk of transmission of blood borne infections and abcesses, and suffers from a lack of access to health care and social services Page of Strengths ... reported increases in risk behavior such as needle reuse as well as a dramatic decrease in access to services Contacts with vulnerable clients have been lost and thousands of needles are unaccounted ... other areas of the community Changes in Access to Services As outlined above, the hours of service for needle exchange and access to nursing services and other housing and social services have...
- 8
- 311
- 0
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx
... to the Rasch analysis, to be analysed on a domain-specific basis and also to test if an overall summary scale could be derived Rasch Analysis Rasch analysis is a modern psychometric approach ... validity of the fit across both the samples The Physical, Cognitive, and Summary scales all achieved a level of reliability necessary for use in individuals Targeting The final scales displayed ... estimates are converted to the same range as the raw score by a further simple linear transformation This nomogram can be used to obtain linear estimates from the raw scores of other samples...
- 10
- 356
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25