the ack and the fin bits are set this is a fin ack in response to a received fin segment

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

Ngày tải lên : 18/02/2014, 12:20
... for maintaining a balanced supply of the DNA precursor This underlines the importance of elucidating the molecular and structural background of the enzymatic and catalytic properties of human thymidine ... at )80 °C before use for kinetic and molecular mass analyses The activity at saturating conditions was similar before and after dilution, incubation and storage Native molecular size The apparent ... analogous to the a and b phosphate groups in the nucleotide ADP On the other hand, the large difference in phosphate donor capacity, only 4% with ADP and no activity with NaPPP and NaPP, indicates that...
  • 10
  • 647
  • 0
Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf

Báo cáo khoa học: The calcium-binding domain of the stress protein SEP53 is required for survival in response to deoxycholic acid-mediated injury pdf

Ngày tải lên : 23/03/2014, 10:21
... forward 5¢-GGGGACAAGTTTGTACAAAAAAGCAG GCTCCATGCCTCAGTTACTGCAAAACATTAATGGG ATCATCGAGGCC-3¢; reverse 5¢-GGGGACCACTTTGT ACAAGAAAGCTGGGTCGGCCAGCGGCTTAAGGTT TTATTGATGCATTAGGGTAGATGGGGC-3¢ Human SEP53 ... standard to quantify the bile acids from patients Standard ratios represent the peak area of each mgÆmL)1 standard compared with the peak area of the internal standard (B) Summary of the range ... of the calcium-binding domain of SEP53 attenuated is activity as a survival factor in a clonogenic assay, we also evaluated whether the response to DCA required the calcium-binding domain Stable...
  • 18
  • 370
  • 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot

Ngày tải lên : 16/03/2014, 06:20
... ATGGGATATGTTCTCAGT ACAGATTTACGACTCCTCCTG CATGTTGCTGTAGCAGTTTGAT ATATAAGCTTATCCTCTGATAGC GACCCATCATCGAGGACTA ACCACAAGGGTTTCAAGCAG CCACACCAGGAAGGTCTTGT GGTGGAGGAAACCTTGGACT ACGTCAACATGTCCGACAAA ... AK LF AK SF AK LR AK SR eIF 4A LF eIF 4A SF eIF 4A LR eIF 4A SR CAATCCATCAAAACCGTGTG TGCTACAGCAACTGGTGATCAGAAGGG CCCTTCCTGATCACCATGTTGCTGT GGCCATCATACAGGTGACTAGGAGGGT GGGTGATTTGACACACGGTTTTGATGGA ... a more than 30-fold increase in lactate, whereas the levels in controls remained constant The arginine kinase gene (AK) and the eukaryotic translation initiation factor 4A gene (eIF 4A, DQ667140)...
  • 12
  • 474
  • 0
Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Báo cáo khoa học: Proteolysis of the tumour suppressor hDlg in response to osmotic stress is mediated by caspases and independent of phosphorylation pot

Ngày tải lên : 23/03/2014, 06:20
... roles during the execution phase of apoptosis [24] We observed a parallel activation of these proteases, the activation of caspase being transient and the activation of caspase being stronger and ... (Nottingham, UK) Immunoblotting with the following antibodies against the indicated marker proteins were carried out as control: anti-calpain for the cytoplasmic fraction and anti-(insulin receptor) ... N-acetylTyr-Val-Ala-Asp-7-amino-4-metylcoumarin for caspase 1, N-acetyl-Asp-Glu-Val-Asp-7-amino-4-metylcoumarin for caspase 3, N-acetyl-Val-Glu-Ile-Asp-7-amino-4-trifluorometylcoumarin for caspase...
  • 14
  • 360
  • 0
Báo cáo khoa học: BRCA1 accumulates in the nucleus in response to hypoxia and TRAIL and enhances TRAIL-induced apoptosis in breast cancer cells pdf

Báo cáo khoa học: BRCA1 accumulates in the nucleus in response to hypoxia and TRAIL and enhances TRAIL-induced apoptosis in breast cancer cells pdf

Ngày tải lên : 30/03/2014, 03:20
... hypoxia could stimulate TRAIL signaling, leading to the activation of two distinct pathways One pathway might lead to increased nuclear localization of BRCA1 and the other to apoptosis Hypoxia could ... BRCA1 shRNA Thus, these data support the hypothesis that BRCA1 enhances TRAIL’s ability to mediate apoptosis in breast cancer cell lines Discussion There is increasing interest in the association ... receptors, DR4 and DR5, and recruits Fas-associated death domain protein to the receptors Caspase-8 is activated and subsequently activates downstream caspases Hypoxia inhibits TRAIL-mediated apoptosis...
  • 10
  • 392
  • 0
Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc

Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc

Ngày tải lên : 30/03/2014, 15:20
... 5¢-ATCTGGAGAGCACATCATTGCTGGTGCA-3¢ 5¢-ACATCGAGGAAGAGTTTTCTATCCTGGA-3¢ 5¢-ACATCGCTGAGAATGTCAACGGGGATAT-3¢ 5¢-CTTTCTGGCCTCTCCAACATCCATGCCA-3¢ 5¢-ATGCCAAGGTAGTTTATGATGATCGAGA-3¢ 5¢-TCTCCTACGATCATCTCACCGTCACCGA-3¢ ... 5¢-GCACAGTTCCCCTACAGTCCCGCTTTAG-3¢ 5¢-CACGTCTCAGCAGGGAGAATAATCCCGA-3¢ 5¢-GAGCTCAGCGAGGACGGAAACCTCGCGT-3¢ ADI (up) 5¢-CCAATCAGGTAGGCCTTCATGGAGAGGA-3¢ 5¢-CCCAGAGATCCTCCAAGAGACAGCCAGT-3¢ ADI (up) ADI (down) ADI (down) 5¢-ATCTGGAGAGCACATCATTGCTGGTGCA-3¢ ... ADI and G (up) ADI (up) G (up) G (up) 5¢-GTGCATCAAAGAATTTTGGATAC-3¢ 5¢-AGAGAAGTGGCAGCTTTCGCTCAGTTTGG-3¢ 5¢-CTCGGCAAAGAAACCGCTGGTTCCTCCCA-3¢ 5¢-GAGACGTCCAGGAAATCTTCCGCAACACC-3¢ 5¢-CAGAGTGTGCACTAGCATGCGGTCCCGT-3¢...
  • 14
  • 413
  • 0
Báo cáo lâm nghiệp:"Growth and biomass partitioning of Fagus sylvatica L. and Quercus robur L. seedlings in response to shading and small changes in the R/FR-ratio of radiation" pot

Báo cáo lâm nghiệp:"Growth and biomass partitioning of Fagus sylvatica L. and Quercus robur L. seedlings in response to shading and small changes in the R/FR-ratio of radiation" pot

Ngày tải lên : 08/08/2014, 01:21
... Castanopsis fargesii and by Wiebel et al [53] for Garcinia mangostana In addition, an increasing number of branches of young Quercus petraea and an increasing length growth of these branches with increasing ... for placing the site for the experiment at my disposal and for their assistance in constructing the wooden frames of the nets and measuring the seedlings I also thank K Thoroe for measuring the ... Seeding and Planting at Teisendorf (Bavaria, Germany) in open field All seeds of a species originated from the same stand, which was selected according to the law on forest reproductive material...
  • 9
  • 341
  • 0
Báo cáo khoa học: "The behavior of oaks in response to natural and induced exposure to the surfactant ABS" potx

Báo cáo khoa học: "The behavior of oaks in response to natural and induced exposure to the surfactant ABS" potx

Ngày tải lên : 08/08/2014, 19:21
... a substance such as ABS are harmful to oaks The morphological and physiological alterations to the leaf waxes have biological consequences, increasing the cuticular transpiration rate and leaving ... were sprayed again in 1991: initial data revealed structural degradation of the leaf waxes similar to that of the year before, but the relative tolerance among the species was unchanged In the culture ... analysis, is common along the Tuscan coast and in hilly areas further inland and for several years has exhibited abnormally intense flowering (Gellini and Paoletti, 1990) Pollen for our study was...
  • 5
  • 302
  • 0
báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

báo cáo khoa học: " The Arabidopsis translocator protein (AtTSPO) is regulated at multiple levels in response to salt stress and perturbations in tetrapyrrole metabolism" potx

Ngày tải lên : 11/08/2014, 11:21
... aaaaagcaggctccatggattctcaggaca TSPO NT2 aaaaagcaggctccatggccgagacagagagg TSPO NT3 aaaaagcaggctccatggcgaaacgtggtctc TSPO CT1 agaaagctgggtccgcgacagcaagctttaca TSPO CT80 agaaagctgggtcggacttagctcgattcccgta Balsemão-Pires ... cloning and genotyping PRIMER NAME FOR GENOTYPING AND CLONING SEQUENCE AtTSPO LP agagcaaatcgcatcagcgtc AtTSPO RP ggaacgtaaccggatcccaaa LBa1 tggttcacgtagtgggccatcg TSPO NT1 aaaaagcaggctccatggattctcaggaca ... TGGTGCTATGGCTGTCTCAAAC FC2 RVS AGCGGAACTAACGACTGTCGA Methods CAO FWD TGATGAGCCACCTGCACCTAT Plant material and growth conditions CAO RVS AAGTAAACCGTGTTCCACCGG PPO FWD GCTTCTTCCGTCGTTTTCGAA Arabidopsis...
  • 17
  • 368
  • 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

Ngày tải lên : 11/08/2014, 11:21
... NRP -A and NRP-B, an ubiquitin-associated (UBA) protein homolog and NAC (NAM, ATAF1, ATAF2 and CUC2) domaincontaining proteins NAC proteins are plant specific transcriptional factors that are involved ... phenotypes, and acts antagonistically to suppress ABA-mediated responses As ABA is a central regulator of plant adaptation to drought [30,31] and plays a crucial role in the regulation of transpirational ... bacterial pathogen attack and induce a defense response [25], and then we inoculated soybean leaves with the incompatible bacterium, Pseudomonas syringae patovar tomato (Additional file 3), as...
  • 14
  • 254
  • 0
báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

Ngày tải lên : 11/08/2014, 11:21
... (5’-AAGCTTATGAGA GGTCGTATAAGTA-3’), containing a HindIII site, and Vv60R3 (5’-TCTAGAGGCCTTCCTATGGCTT-3’), containing an XbaI site, and the PCR fragment was cloned in the pBI101.3 vector The VvMYB30 ... (5’-GGATCCATGGGAAGGCCTCCTTGCT-3’) and Vv30R2 (5’-AAGTCTGACAGTGATGAGAGGAGC3’); Vv60F2 (5’-CTCCTTGCTGTGATAAAGTTGGTAT3’) and Vv60R2 (5’-ATTCAGGTTTTCGTACTCAAGAATG-3’) The control AtACTIN2 gene (At3g18780) ... t-test) (H) and (I) Histochemical analysis of GUS expression in pVvMYB60:GUS leaves in response to ABA (H) GUS staining of stomata in a control leaf (I), GUS staining of stomata following hours...
  • 15
  • 316
  • 0
báo cáo khoa học: " Comparison of the transcriptomes of American chestnut (Castanea dentata) and Chinese chestnut (Castanea mollissima) in response to the chestnut blight infection" doc

báo cáo khoa học: " Comparison of the transcriptomes of American chestnut (Castanea dentata) and Chinese chestnut (Castanea mollissima) in response to the chestnut blight infection" doc

Ngày tải lên : 12/08/2014, 03:20
... along the Appalachian Mountains to Alabama and westward to the Mississippi river [2] In some areas up to 45% of the forest canopy was comprised of American chestnut [3] This large, fast-growing ... transcriptome characterization and gene discovery Transcriptome comparison between canker tissues from Castanea mollissima and Castanea dentata GO annotation analyses showed that, overall, canker tissues ... protein This protein kinase activates both local resistance and basal resistance [38,46,47] It also appears from our data that metabolic flux may be involved in the chestnut resistance to the...
  • 11
  • 370
  • 0
Báo cáo khoa học: " Endocrine and Ovarian Changes in Response to the Ram Effect in Medroxyprogesterone Acetate-primed Corriedale Ewes" ppsx

Báo cáo khoa học: " Endocrine and Ovarian Changes in Response to the Ram Effect in Medroxyprogesterone Acetate-primed Corriedale Ewes" ppsx

Ngày tải lên : 12/08/2014, 15:21
... performed; Andrea Pinczak, Leticia Silva, and Mariana Laca for help with animal management; Ignacio Videla (Syntex SA, Buenos Aires, Argentina) for providing us with the sponges and Novormón; and Ricardo ... Iglesias for laparoscopic observations Thanks are also due to M. -A Carlsson and Å Karlsson for RIA analysis, and to Dr A. F Parlow and Dr J Roser for supplying hormone and antibody preparations ... experiment was carried out on a commercial farm near Trinidad, Uruguay (33° SL), during the mid-breeding season (April-May) Alto- Endocrine and ovarian changes in response to the ram effect gether 71...
  • 12
  • 319
  • 0
Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

Báo cáo khoa học: "RAGE: Exacting a toll on the host in response to polymicrobial sepsis and Listeria monocytogenes" pps

Ngày tải lên : 13/08/2014, 10:20
... organism [6,7] In the initial phase of infection, Listeria binds to splenic macrophages and is internalized; Listeria produces products that activate nuclear factor-kappa B and upregulate innate ... cytokine is not absolutely linked to the initial clearance of L monocytogenes, these findings are consistent with the notion that the RAGE-induced proinflammatory state may be deleterious in the ... Pamer [5], in the first few days of Listeria infection, the innate response is critical for early bacterial clearance and host survival The adaptive response instead is required for controlling...
  • 3
  • 286
  • 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Ngày tải lên : 13/08/2014, 18:22
... 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets ... before in other Sub-Saharan African settings The translators were extensively trained and the translation was discussed in detail Nevertheless, cultural bias might have influenced the findings, as ... developmental stages, attachment, and bonding was given to the caretakers to foster their understanding and empathy towards the children Grief: As many of the children have lost their parents also some...
  • 9
  • 405
  • 0
Building business strategy of the Petrovietnam oil corporation - one member company limited (PVOIL) phase in 2013 to 2018 and vision to 2025

Building business strategy of the Petrovietnam oil corporation - one member company limited (PVOIL) phase in 2013 to 2018 and vision to 2025

Ngày tải lên : 26/03/2015, 11:06
... To analyze the financial situation of the business need to use the data from the financial statements of the business for some of years and compare these indicators together The indicators can ... OIL’s business strategy Comparison of financial analysis indicators for 2011 and 2010; 2010 and 2009; 2011 and 2009; Table 2.3.3.5b Analysis of financial indicators FINANCIAL INDICATORS SS 11 ... managers and experts of the PV OIL and experts are active staff in the field of oil and gas business in the company of Vietnam In addition, the research information and data to be gathered and...
  • 131
  • 1.1K
  • 2
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Ngày tải lên : 18/02/2014, 16:20
... proliferator-activated receptor-alpha (PPARa) and peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC-1), pivotal nuclear regulators of numerous fatty acid metabolic genes [10] In ... and Discussion The main finding of this study is the identification of a metabolic gene switch from fatty acids to glucose in the murine female heart at baseline linked to enhanced mitochondrial ... myocardial glucose metabolism may be increased in parallel As optimization of glucose metabolism is increasingly highlighted as a therapeutic intervention for ischemia-induced and ischemia–reperfusion-induced...
  • 7
  • 582
  • 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

Ngày tải lên : 07/03/2014, 10:20
... ⁄ PAGE After drying of the gels, labeled proteins were visualized by autoradiography, and quantified by a PhosphorImager with imagequant 5.0 software MS The N-terminal amino acids and internal ... left) After incubation at 30 °C for 15 min, the mixtures were separated on 5% polyacrylamide gels, and then subjected to autoradiography The retarded DNA fragments are indicated (a, b, c and d) The ... (GGGCGTCGG) near to its 3¢-end (data not shown) This is in accordance with the fact that the helix–turn–helix DNA-binding domains of SenR and ChrA share 61% amino acid identity (data not shown) The designed...
  • 14
  • 428
  • 0
Nano product preview march 2009  the applause   “ this is a fantastic effort”

Nano product preview march 2009 the applause “ this is a fantastic effort”

Ngày tải lên : 15/03/2014, 22:14
... Acetoacetic Ester Acetoacetic Ester O H3C O C C H C OCH2CH3 H Acetoacetic ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant ... OCH2CH3 The anion of ethyl acetoacetate can be alkylated using an alkyl halide (SN2: primary and secondary alkyl halides work best; tertiary alkyl halides undergo elimination) R 21-6 Conversion to ... CO2 Saponification and acidification convert the alkylated derivative to the corresponding β-keto acid The β-keto acid then undergoes decarboxylation to form a ketone 21-8 Example Example O O CH3CCH2COCH2CH3...
  • 52
  • 1.1K
  • 0
Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Báo cáo khoa học: The Cockayne syndrome group B protein is a functional dimer docx

Ngày tải lên : 23/03/2014, 15:20
... USA) This vector encodes N-terminal S- and HIS- tags and C-terminal HIS- and HSV-tags The fragments were over expressed in E coli and purified using Ni-NTA agarose (Qiagen, Valencia, CA, USA) ... molecular mass of 168 kDa, this indicates that CSB is a dimeric protein DNA was not present in these fractions since the ATPase activity was only detectable after the addition of pUC19 DNA This indicates ... advance the understanding of the mechanism by which the DNAdependent ATPases, in general, and CSB, in particular, functions Furthermore, oligomerization status is important to evaluate the stoichiometry...
  • 9
  • 273
  • 0

Xem thêm