that on every man a divine character is imprinted by the vertue of which man can attain the working of miracles
Báo cáo khoa học:" The directionality of the nuclear transport of the influenza A genome is driven by selective exposure of nuclear localization sequences on nucleoprotein" pptx
Ngày tải lên :
12/08/2014, 04:21
... Whittaker for kindly providing the NP cDNA This work was supported by grants from the Canada Foundation for Innovation (CFI), the Canadian Institutes of Health Research (CIHR), and the Natural ... molecular mechanism of this masking awaits further studies, but we believe that this study provides the basic underlying mechanism that regulates the directionality of the nuclear trafficking of ... to an NP posttranslational modification, its binding to a cellular protein, or a conformational change in NP Which of these mechanisms act to prevent nuclear re-entry awaits further studies Conclusion...
- 12
- 196
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
Ngày tải lên :
20/02/2014, 02:21
... sequestering components of the basal transcription machinery 5201 Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence ... fragments containing TATATAA sequences Transcription of tRNA1Gly -1 was carried out in the presence of increasing concentrations of a 40 bp fragment containing the TATATAA sequence upstream of the coding ... in the nuclear extracts This study established that transcriptional inhibition was achieved through sequestration of the basal transcription factor TFIIIB, as well as the formation of unstable...
- 15
- 484
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A ... Tamagawa, H., Iwakura, K., Tsunasawa, S & Tsunemitsu, A (1990) Characterization of superoxide dismutases purified from either anaerobically maintained or aerated Bacteroides gingivalis J Bacteriol ... contrast, however, addition of a second glutamine residue to the manganese enzyme (Mn[G77Q]) leaves the mutant with about half the specific activity of the wild-type enzyme A final contrast can...
- 12
- 740
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
Ngày tải lên :
07/03/2014, 16:20
... organization of the transcription initiation region of the Drosophila a- F1ATPase gene constitutes a clear example of the flexibility in the basal promoter region of animal genes The promoter is TATA-less, ... confirmed that they corresponded to cDNAs originated by the alternative selection of polyadenylation signals located at position 101 and 462 downstream of the TAA translation stop codon (Fig 6C) Northern ... critical for the activation of the a- F1-ATPase promoter Computer analysis revealed the presence of two DNA sequence motifs in this region potentially recognized by the GAGA factor (GAF) and the alcohol...
- 11
- 532
- 0
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
Ngày tải lên :
08/03/2014, 02:20
... investigated the effect of a long-term PKA activation on mature TACE disappearance Activation of PKA by dibutyryl-cAMP, a more stable cAMP analogue, did not influence the degradation of mature TACE ... that there is redundancy in the proteolytic maturation of TACE as other members of the PC family can compensate a lacking furin activity Therefore, we cannot exclude that additional members of ... colocalization of TACE and furin in a cellular compartment where TACE is degraded There furin probably acts as a cofactor which activates the TACE degrading cascade Reconstitution of furin activity...
- 8
- 422
- 0
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
Ngày tải lên :
16/03/2014, 11:20
... excluded the possibility that this was a consequence of enzyme denaturation by assaying the enzyme during incubation A reasonable explanation is that NADPO was acting as a competitive inhibitor of the ... description of this reaction, along with a detailed analysis of the spectroscopic properties of the product of NADP+ oxidation Fig Hypothetical mechanism of the reductive half-reaction of the catalytic ... evidence that such a reaction was occurring was the observation that crystals of FprA grown in the presence of NADP+ contained NADPO bound to the active site instead of NADP+ [4] Comparison of the...
- 10
- 406
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
Ngày tải lên :
30/03/2014, 04:20
... the inactivation and fragmentation of calpastatin are known to be produced by active calpain [32], these observations further indicate that calpain is activated in both tissues, although at a ... intracellular Ca2+ concentration ([Ca2+]i) by the administration of a high-sodium diet (HSD) [28], and studied calpain degradation of NOS and HSP90 in brain and aorta To amplify the range of fluctuations ... significant degradation of HSP90, which was only partially B Fig Levels of calpain isoforms and calpain substrates in the aorta of NMS and HMS rats treated with HSD Aliquots (100 lg protein) of brain...
- 11
- 344
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
Ngày tải lên :
18/06/2014, 15:20
... software (ABI, Darmstadt, Germany) The coincidence of the -173 C allele and the -794 CATT7 microsatellite was described as an inferred haplotype Statistical analysis of genotype distribution and ... and allele frequency was done by chi-square Test and Fischer's exact Test where applicable The analysis of statistical differences of SOFA score and plasma levels (IL-6, PCT) was done by Mann-Whitney-U ... analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association...
- 8
- 554
- 0
– THE GRE ANALYTICAL WRITING SECTION – The argument, as given, is weakened by the fact that it docx
Ngày tải lên :
18/06/2014, 17:20
... analysis of the issue and communicates some meaning, but contains apparent flaws The essay at this level contains at least one of the following flaws: ■ ■ ■ ■ ■ ■ vague or limited analysis of the ... clear and perceptive identification and analysis of significant aspects of the argument clear and logical organization, connecting ideas fluently with appropriate transitions rational and logical ... weakened the author’s claim? Are there other explanations, besides the ones given, that they author did not address? Is there a particular kind of evidence that you know of that contradicts the author’s...
- 25
- 377
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
Ngày tải lên :
20/06/2014, 23:20
... (Tobajas et al 2009) Fermentation was carried out at 37°C and 250 rpm, in an anaerobic condition The pH was maintained at 5.5 by the addition of 1.5 M NaOH or 1.5 M H3PO4 (El-Ziney et al 1998) The ... glycerol to a concentration of ~1.5 × 1010 cells/mL and incubated anaerobically at 37°C for h After the h incubation, the culture was pelleted and the 3-HPA-containing supernatant was collected and filter-sterilized ... relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are growth-associated in both the native...
- 8
- 399
- 0
Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc
Ngày tải lên :
07/08/2014, 15:23
... with a proof of Theorem 1.1) We remark that our constants are not unreasonable (see Theorem 3.4) B¨r¨czky, Pach and T´th showed [2] that for every surface χ there is a constant c χ oo o such that ... grows quadratically with their size, which finishes the main proof Theorem 3.3 Let G be a graph that contains an I–collection of size k > M g , where Mg is the constant in Proposition 3.2 Then the ... Let G denote the plane graph derived in this way from G We claim that G contains a collection of r pairwise disjoint paths P1 , , Pr , and a collection of r/2 pairwise disjoint paths Q1 , ...
- 8
- 336
- 0
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot
Ngày tải lên :
10/08/2014, 09:21
... principal study RW performed the CMR exams and data analysis JY performed the CMR exams and data analysis DV statistical analysis VR helped interpret CMR exams served as the second cardiologist on the ... study GR assisted in primary data analysis and was the software engineer for the study KC participated in the study as the cardiology fellow and separately analyzed mitral regurgitation data MD helped ... design, analysis and performance of the study as well as implemented optimization of the RF tissue-tagging sequence, critical discussions of the study results, critical analysis of the various drafts...
- 8
- 332
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
Ngày tải lên :
18/02/2014, 13:20
... 5¢-CAAAACGCTCTACAGGC TCC-3¢, 5¢-GAAGAGCTGGACAGAGGTGG-3¢ (ZO-1), 5¢-TTATGGGCCACCGGATATTA-3¢, 5¢-GGAGAGTCA CTGAAGGCTGG-3¢ (DLG-2), 5¢-AAGCTAAGAGGCA CGGAACA-3¢, 5¢-TCCTTATTGCCAGCGAGACT-3¢ (Patj), ... 5¢-TTGCAGACGGAAGAGGTTCT-3¢, 5¢-GGCCACTT TCAGCATCAAAT-3¢ (Erbin), 5¢-GCGGATCCGCAT GTTGGAAACCATAGAC-3¢ and 5¢-GCGAATTCGA CATTTTTAGTGAGTTCCAC-3¢ (MUPP1) Antibodies Primary antibodies used were: anti-adenylyl ... interaction Further studies are necessary to shed light on the function of this interaction in the in vivo situation By influencing the duration of the Ca2+ signal of ORs in the cilia of the sensory...
- 12
- 543
- 0
Báo cáo khoa học: Androgen receptor function is modulated by the tissue-specific AR45 variant ppt
Ngày tải lên :
07/03/2014, 16:20
... modulating androgen action Results Identification of AR45, a novel variant of the human AR 5¢ Rapid amplification of cDNA ends (RACE) was performed on human placental RNA using a reverse FEBS Journal ... depending on the promoter context and availability of cofactors AR45 may act as a dominant-negative inhibitor of AR function As intact ligand- and DNA-binding regions are mandatory for 80 I Ahrens-Fath ... (Stratagene) The following primers were used for AR45: 5¢-ACA GGGAACCAGGGAAACGAATGCAGAGTGCTCCTGA CATTGCCTGT-3¢ and 5¢-TCACTGGGTGTGGAAATA GATGGGCTTGA-3¢ Reaction conditions were: five cycles of s at...
- 11
- 514
- 0
Effects of compost and phosphate amendments on arsenic mobility in soils and arsenic uptake by the hyper
Ngày tải lên :
16/03/2014, 00:07
... distribution in the CCA and ASC soils WE–As, water-soluble and exchangeable; Al–As, As associated with Al; Fe–As, As associated with Fe; Ca–As, As associated with Ca; Rs–As, residual As No significant ... Fe–As It can be assumed that the displacement of As by P readily occurred on the surface of the Fe particles and that Fe was readily reduced in the anaerobic soil condition induced by compost addition, ... obtained by GFAAS 2.8 Data analysis All results are expressed as an average of three replicates, and treatment effects were determined by analysis of variance according to the general linear model...
- 11
- 707
- 0
Báo cáo khoa học: The expression of retinoblastoma and Sp1 is increased by low concentrations of cyclin-dependent kinase inhibitors ppt
Ngày tải lên :
16/03/2014, 23:20
... cerevisiae, as measured by array methods [47] Given that the modulation of CDK activity is an attractive target for cancer chemotherapy, we studied the changes produced by low concentrations of ... hamster ovary (CHO) K1 and human cells by a mechanism involving transcriptional activation and, also in the case of Rb, by an increase in its stability Materials and methods Materials UCN-01 was kindly ... mechanisms On the one hand, there is an increase in transcription, as shown by the luciferase experiments and in the levels of Rb mRNA; and, on the other hand, the stability of Rb protein is increased...
- 14
- 486
- 0
Báo cáo khoa học: Proteolytic degradation of nitric oxide synthase isoforms by calpain is modulated by the expression levels of HSP90 potx
Ngày tải lên :
23/03/2014, 07:20
... and, in the case of eNOS, with the cleavage of a single bond HSP90 isolated from Jurkat cells was also digested by calpain with the transient accumulation of an 85–86 kDa band that replaces the ... M Averna et al the acquirement of the active conformation and the fully functional state of the synthases [14–17], and recruitment of active calpain, which prevents the inactivation of NOS Discussion ... site that leads to the loss of catalytic activity in both isoforms [2,4] The addition of CaM has no effect on the pattern on digestion (data not shown) Our findings appear to indicate that the...
- 12
- 338
- 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
Ngày tải lên :
30/03/2014, 04:20
... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... decreased transcription rate for PSD1 and a defect in Psd1p maturation are the molecular basis of the decreased rate of PtdSer decarboxylation in oxa1D mitochondria One obvious explanation for the...
- 11
- 354
- 0
Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx
Ngày tải lên :
30/03/2014, 21:20
... Event Coreference Method Validated Validated Validated Validated Validated Validated Manual Validated Manual Validated Validated Manual Validated Manual Manual Manual No texts 118 118 118 118 ... appropriate metadata together with machine-processable information about associated annotations and interrelations among the annotation layers; and (2) a segmentation of the primary data into minimal ... the underlying representation of the stand-off annotations, but gains all the advantages that representation offers The following output formats are currently available: Validation Automatically-produced...
- 6
- 374
- 0
báo cáo hóa học: " Astrocyte production of the chemokine macrophage inflammatory protein-2 is inhibited by the spice principle curcumin at the level of gene transcription" pptx
Ngày tải lên :
19/06/2014, 22:20
... design, acquisition of data, supervised all experiments, and carried out isolation of astrocytes, ELISA and transfection assays 15 BH isolated and amplified the MIP-2 gene promoter, and generated the ... b abrogated the influx of neutrophils to the meninges, ventricular system, and the periventricular areas of the brain and substantially decreased neuronal damage[11] List of abbreviations In addition ... polyclonal antibody was obtained from Dako Corp (Carpinteria, CA) Preparation and culture of astrocytes: Astrocytes were prepared from the brains of neonatal (3 to 7-day-old) CBA/ CaJ mice by a modification...
- 7
- 385
- 1