test a spy was called a specific number of times

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Ngày tải lên : 15/03/2014, 07:20
... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... historical inflation Model-derived inflation expectations also have a number of advantages over expectations from market economists: unlike survey-based expectations, they are again available at any ... inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations...
  • 32
  • 347
  • 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Ngày tải lên : 16/03/2014, 00:20
... design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide ... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... purchased from Sigma All other chemicals were reagent grade For antimicrobial assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18)...
  • 18
  • 494
  • 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

Ngày tải lên : 22/03/2014, 20:20
... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... inflation expectations and inflation risk premia Due to a lack of data we cannot this and instead estimate inflation forward rates as part of our model 18 inflation, a low 2-year break-even inflation...
  • 39
  • 395
  • 0
Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Báo cáo khoa học: "GENERATING A SPECIFIC CLASS OF METAPHORS" pptx

Ngày tải lên : 31/03/2014, 06:20
... view of focus of attention a word is treated as having a static semantics However metaphor can make the semantic type of objects more flexible By using a verb that only applies to humans, as above, ... terms of a moving vehicle at the same time emphasizing the effort that it takes to leave (as in section 3.3) A party can be described, via "is -a" links of the abstraction hierarchy, as a human process ... level of abstraction, where the key role (termination) is specified, we can search for a candidate metaphorical domain that shares this ancestor There are several possible metaphorical domains that...
  • 3
  • 267
  • 0
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx

Ngày tải lên : 23/06/2014, 00:20
... Complex and Adaptive Laboratory, involved in artificial intelligence applications His main interests are radar data processing, navigation, and air traffic management, with special stress on data fusion ... respect to the radar (radial and tangential projection of velocity heading), magnitude of the transversal acceleration, and magnitude of the groundspeed change There are four quality parameters in ... The design of a tracking filter aims at attaining a satisfactory trade-off among all specifications The quality of the design will be evaluated by means of simulation over 22 test scenarios, producing...
  • 14
  • 342
  • 0
Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx

Ngày tải lên : 07/08/2014, 06:20
... a substantially improved paper the electronic journal of combinatorics (2000), #R50 11 References [1] M Abramowitz and I .A Stegun, Eds., Handbook of Mathematical Functions with Formulas, Graphs ... Formulas, Graphs and Mathematical Tables, Dover Publications, New York, 1966 [2] E .A Bender, Central and Local Limit Theorems Applied to Asymptotic Enumeration, J Combinatorial Theory A 15 (1973), ... |t|m (6) Of course, our error terms a, b and cm are all infinitely-differentiable functions over the reals We also require the following inequality (integration by parts) For a real number x >...
  • 11
  • 348
  • 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Ngày tải lên : 09/08/2014, 06:22
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... sera (all from SLE patients) containing anti-Sm antibodies that were available in greater quantities preselected by ELISA (Varelisa® Sm; Pharmacia Diagnostics, Freiburg, Germany) was used Autoimmune ... peptide was subsequently used to develop an ELISA system based on the general protocol of the Varelisa® tests (Pharmacia Diagnostics) Assay performance characteristics To evaluate the performance of...
  • 11
  • 593
  • 0
Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx

Ngày tải lên : 09/08/2014, 07:20
... Kizawa H, Kou I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, et al.: An aspartic acid repeat polymorphism in asporin inhibits chondrogenesis and increases ... (European Union), and by a grant of the Fundacion Pedro Barrie de la Maza (A Corunna, Spain) JR-L is the recipient of a scholarship of the National Program for the Training of University Professors ... M, Kanavakis E, Fytili P, Chouliaras G, Karachalios T, Malizos K, Tsezou A: Asporin and knee osteoarthritis in patients of Greek origin Osteoarthritis Cartilage in press Altman R, Alarcon G, Appelrouth...
  • 4
  • 431
  • 0
Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot

Ngày tải lên : 09/08/2014, 09:20
... DMSO before irradiation on ice and sample preparation Alternatively, cells were incubated for repair prior to lysis Data analysis involved quantification of the fraction of total DNA mass in electrophoretically ... MDC1 regulates intra-S-phase checkpoint by targeting NBS1 to DNA double-strand breaks Proc Natl Acad Sci USA 2008, 105:11200-11205 19 Ayoub N, Jeyasekharan AD, Bernal JA, Venkitaraman AR: HP1-β ... breaks repair only at low levels of DNA damage Cell Cycle 2006, 5:1116-1122 41 Nazarov IB, Smirnova AN, Krutilina RI, Svetlova MP, Solovjeva LV, Nikiforov AA, Oei SL, Zalenskaya IA, Yau PM, Bradbury...
  • 13
  • 289
  • 0
Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx

Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx

Ngày tải lên : 09/08/2014, 18:21
... that N and L are rather e e large, the approximation is still correct for values of L as small as A similar analysis can be carried out for the model assuming a constant environmental variance, ... breeding value of a zygote,’ to which a Gaussian random variable is added to simulate the environmental effect The additive effects of alleles are drawn in the initial generation from a Gaussian distribution, ... any value is written in the following way: ) f and g( value of a gamete and y a residual assumed to be random, so that the variance covariance matrix of Matings gene effects in new zygotes takes...
  • 22
  • 186
  • 0
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Ngày tải lên : 12/08/2014, 17:20
... copies of each chromosome The description data of the two copies are called a genotype while those of a single copy are called a haplotype A specific location in a chromosome is called a site and its ... sites to an arbitrary small number of sites Preliminaries A member is an individual A set of members is called a family if it includes only two parents and their children; it is a parent-offspring ... is a finite alphabet and Σ* is the set of all strings over that alphabet The second component is called the parameter of the problem Practically, the parameter is a nonnegative integer or a set...
  • 8
  • 241
  • 0
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot

Ngày tải lên : 14/08/2014, 17:22
... Biosystems) Data Our data are freely available at the proteome database of the department of proteomics and signal transduction of the Max-Planck-Institut for Biochemistry [45] Additional data files ... following additional data are available with the online version of this paper Additional data file lists all peptides and protein hits obtained in both LTQ-FT and LTQ-Orbitrap data Click here data Orbitrap ... CTSD Cathepsin G CTSG Cathepsin Z CTSZ Prostasin† PRSS8 Aminopeptidase B† RNPEP Tissue alpha-L-fucosidase FUCA1 12 Beta-mannosidase* MANBA 13 Alpha-N-acetylglucosaminidase* NAGLU 12 Neuraminidase...
  • 11
  • 289
  • 0
Fabrication of gold nanoparticle DNA conjugates bearing specific number of DNA for quantitative detection and well defined nanoassembly

Fabrication of gold nanoparticle DNA conjugates bearing specific number of DNA for quantitative detection and well defined nanoassembly

Ngày tải lên : 12/09/2015, 11:29
... introduction of target DNA analyte and formation of dsDNA leads to the release of DNA from nAu and regain of fluorescent signal This assay was developed to be finished within 10 and has a sensitivity of ... 6.8 Hybridization efficiency of pure DNA (strand A and strand revA with different ratios of target DNA) Lanes 9-13 and correspond to strand A & strand revA with target DNA at a ratio of 1:1:0.2, ... using dsDNA of 10, 20, 40, 67, 110, and 250 base pairs as the spacer material It was found that the shifting of plasmon resonance wavelength is a function of nanoparticle separation and decays exponentially...
  • 174
  • 396
  • 0
Báo cáo y học: " Tuberculosis contact investigation with a new, specific blood test in a low-incidence population containing a high proportion of BCG-vaccinated persons" pdf

Báo cáo y học: " Tuberculosis contact investigation with a new, specific blood test in a low-incidence population containing a high proportion of BCG-vaccinated persons" pdf

Ngày tải lên : 12/08/2014, 16:20
... Bering, Marburg, Germany; equivalent to about TU of PPD-S) was injected intradermally into the volar aspect of the forearm and transverse induration diameter was measured 72 hours later Individuals ... analysis CL and MF participated in the design of the study and the data interpretation KM recruited patients, obtained medical data and assessed results All authors read and approved the final manuscript ... between the date of entry to Germany and the date of contact tracing was 535.4 ± 394 weeks, with a range from 39 to 1601 weeks The mean age of the contacts was 28.5 ± 10.5 years (range 14–53) and there...
  • 9
  • 434
  • 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Ngày tải lên : 26/10/2012, 10:04
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
  • 7
  • 612
  • 1
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

Ngày tải lên : 27/10/2012, 16:41
... FSoft has established FPT Software Japan, Ltd with its headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established ... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier...
  • 79
  • 611
  • 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Ngày tải lên : 07/11/2012, 15:01
... Egyptian American who was teaching Middle Eastern history at Harvard; Heather, the housemate of Sang and Paul, who was a law student at Boston college and her boyfriend, Kevin was working as a physicist ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
  • 49
  • 785
  • 1
Giáo án Anh 12 Unit 3, Test A (chẩn)

Giáo án Anh 12 Unit 3, Test A (chẩn)

Ngày tải lên : 26/06/2013, 01:25
... a nice pair of glasses A : You really have a - a new and expensive watch nice pair of glaases I - a new cell phone think they make you - a modern looking pair of shoes attractive - a fashionable ... appropriate language to talk about other ways of communication Knowledge: - General knowledge: Students can talk about other ways of communication - Language: Words to speak about ways of communication ... to make a complete paragraph - Language: Words used in writing about a paragraph Skills: Writing about a letter of recommendation II Method: Intergrated, mainly communicative III Teaching aids:...
  • 15
  • 1.3K
  • 4