team models as a framework to analyze coordination problems within the firm
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... on the transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the ... change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, moisture and ph changes...
- 4
- 520
- 0
Using eliciting question as a technique to teach english to 11th form pupils
Ngày tải lên :
27/12/2013, 20:26
... this approach in their teaching But the fact is that they have not successfully applied this approach Half of them say that they always let their pupils make questions communicatively in class and ... questions These are questions that give suggestion to make students contribute their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and ... which the questioner already knows For example, when teacher asks students for information that is in the text, and the teacher has already read the text and knows the answers, those are display...
- 42
- 641
- 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
Ngày tải lên :
18/02/2014, 16:20
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased ... fraction that does localize properly only has fractional glucosylceramide hydrolase activity That said, the fractional activity appears to be sufficient to ameliorate disease, when folding and trafficking...
- 7
- 507
- 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc
Ngày tải lên :
19/02/2014, 14:20
... treated in a fair and friendly manner, graciously and courteously • That you want to help them • To see you as the solution to their problem, and not be seen as your problem • To be treated as ... sales are made on the first contact 3% of sales are made on the second contact 5% of sales are made on the third contact 10% of sales are made on the fourth contact 80% of sales are made on the ... withdraw/ avoid dictate/ assert attack/ be sarcastic Seeks attention accuracy productivity recognition Likes you to be pleasant precise to the point stimulating Wants to be liked correct in charge...
- 48
- 482
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... phosphate isomerase, UÆmL)1 glycerol 3-phosphate dehydrogenase and 0.3 U aldolase PK was assayed as described by Crow and Pritchard [30] Final concentrations in assay was: mm GDP, mm PEP, mm fructose ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
Ngày tải lên :
06/03/2014, 22:21
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... activation of caspase shown was calculated from the average of three experiments Each value is expressed as ratio of caspase activation level to untreated level, and the untreated level was set to *versus...
- 13
- 563
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... properties of the lipid phase [35] The mechanisms highlighted above conceivably also operate in the present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired...
- 10
- 452
- 0
A Framework To Identify Gender Indicators For Reproductive Health and Nutrition Programming doc
Ngày tải lên :
22/03/2014, 12:20
... interpret I Accessible—It uses data that are already available or are relatively easy to acquire by feasible methods that have been validated in field trials Educational status and media exposure;* ... separately for males and females, if appropriate I Qualitative or quantitative—Data are either quantitative or qualitative, as appropriate to the objectives of the project A FRAMEWORK TO IDENTIFY ... begins with a careful assessment of health status and the full range Asha Mohamud, Nancy Ali, and Nancy Yinger, Female Genital Mutilation, Programs to Date: What Works and What Doesn’t (Geneva: WHO,...
- 30
- 401
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ...
- 13
- 487
- 0
Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf
Ngày tải lên :
28/03/2014, 11:20
... SRSD To achieve the goals, a 6-stage procedure for SRSD is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke ... The evaluation is internal, i.e evaluating the task against the stated objectives/goals - Evaluators: The teacher and the students directly involve in evaluating the task - Timing: The evaluation ... Department The material is used as a resource rather than a script The teacher is going to examine it to see what learning opportunities it provides and design a curriculum that can add value to the tasks...
- 8
- 518
- 4
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
Ngày tải lên :
30/03/2014, 15:20
... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... presumed to be involved in the pathogenesis of chronic inflammatory diseases such as rheumatoid arthritis and osteoarthritis via regulation of the availability of this cytokine in the matrix [69] In addition, ... coagulation cascade The A subunit of coagulation FXIII (an FXIII A dimer) has been identified in the cytoplasm of platelets, megakaryocytes and monocytes–macrophages [2,3] FXIIIA catalyses the crosslinking...
- 17
- 440
- 0
báo cáo hóa học:" Combined intermittent hypoxia and surface muscle electrostimulation as a method to increase peripheral blood progenitor cell concentration" pot
Ngày tải lên :
18/06/2014, 15:20
... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... hypobaric chamber stay (90 min) and the other in the second 90-min period of stay The protocol of OME was the same as HME and also took place into the hypobaric chamber; however, as the door was ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...
- 6
- 426
- 0
báo cáo hóa học: " F-fluoride PET: changes in uptake as a method to assess response in bone metastases from castrate-resistant prostate cancer patients treated with 223Ra-chloride (Alpharadin)" pdf
Ngày tải lên :
21/06/2014, 02:20
... oncological practice and in clinical trials, to the extent that bone metastases are often regarded as a non-measurable disease [4] Criteria exist which use radiographic changes to measure response ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured ... performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases and castration-resistant prostate cancer Repeated 18F-fluoride PET imaging, PSA and ALP assessments...
- 6
- 286
- 0
Indicators for Soil Quality Defining a framework to measure soil quality (Romanyà et ppt
Ngày tải lên :
06/07/2014, 08:20
... define the general soil degradation thresholds and then at the local scale we also need to address the specificity of the land management impacts, and define the threats associated to a specific ... quality indicators hardly address the processes associated to the new threats to soil such as contamination Soil contamination is a highly complex issue to cope with chiefly when we consider the ... soil management To so we consider the management thresholds According to Schjonning et al (2004) management thresholds can be defined as the most severe disturbance any management may accomplish...
- 4
- 325
- 0
Module V Viruses and Worms.Introduction to VirusComputer viruses are perceived as a threat to potx
Ngày tải lên :
31/07/2014, 04:20
... program ti due to i l t f data in Software Attacks: • Intentionally launched malicious programs enable the attacker to use the computer in an unauthorized manner • General Categories: • Viruses and ... the anti-virus software’s request to read the file and passing the request to the virus, instead of the OS The virus can then return an uninfected version of the file to the anti-virus software, ... Create Computer Viruses Virus writers can have various reasons for creating and g spreading malware Viruses have been written as: • • • • • • • • • Research projects Pranks Vandalism To attack the...
- 38
- 207
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
Ngày tải lên :
09/08/2014, 08:22
... collagen was calculated from ELISA data Both sets of data were obtained from the same protein extraction tube: the PG was located in the supernatant, whereas the type II collagen was located in the ... head The horizontal bar indicates the median, the box is the interquartile range, and the vertical lines indicate the atypical values The Wilcoxon signed rank test was used to compare areas within ... cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP) Aggrecan and type...
- 11
- 520
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
Ngày tải lên :
09/08/2014, 10:21
... H37Ra (MT H37Ra; DIFCO Laboratories, Detroit, MI, USA) was used as an adjuvant to induce arthritis Fresh adjuvant was prepared on the same day as arthritis was induced A volume of 0.1 ml of a mg ... Statistical Package for the Social Sciences software (SPSS Inc Chicago, IL, USA) was used to analyze the data Throughout the study, the mean ± standard error of means was used to describe the ... Murihead KA, Hanna N: Methotrexate inhibits macrophage activation as well as vascular and cellular inflammatory events in rat adjuvant induced arthritis J Rheumatol 1988, 15:745-749 47 Davis P,...
- 7
- 569
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
Ngày tải lên :
09/08/2014, 18:21
... metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs ... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the ... the total number of chiasmatas) is 90-100 in birds, whereas it is on average 50 in mammals [68] Moreover, the domestic species studied (dog, cat, pig, cattle, etc.) tend to have higher chiasma...
- 11
- 318
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0