table a 1 additional functions provided by xslt 1 0

MEALS ARE FREE UNLESS OTHERWISE NOTED: For additional listings provided by the Meals Partnership Coalition pot

Ngày tải lên : 22/03/2014, 21:20

... Contact: Nancy Rogers Phone: 206 -784- 311 9 ext 10 8 Morning snack/coffee: Monday – Friday (8 :00 AM – 10 :00 AM) Breakfast: Monday and Wednesday (8 :00 AM – 10 :00 AM) Lunch: Tuesday and Friday (11 :30AM ... Jr Way Seattle, WA 9 811 8 Lunch: Wednesdays and Fridays ( 10 :30AM – 1: 00 PM) Samoan American Pacific Organization Southgate Masonic Hall 10 04 SW 15 2nd Street Burien, WA 9 816 6 Lunch: Wednesdays and ... 3rd Avenue Seattle, WA 9 812 1 Contact: Hollianne Monson Phone: 206 -436-8672 Breakfast: Daily (8 : 10 AM – 8: 40 AM) Lunch: Daily (11 : 30 AM – 12 :00 PM) Lunch: Daily (12 : 30 PM – 1: 00 PM) Snack: Daily...

15
358
0

Tài liệu Báo cáo khoa học: Kinetics of dextran-independent a-(1 ﬁ 3)-glucan synthesis by Streptococcus sobrinus glucosyltransferase I pdf

Ngày tải lên : 14/02/2014, 22:20

... similar kcat and Km values (data not shown) The kcat and Km values were as follows: GS, 11 .4 ± 0. 4 s )1 and 0. 37 ± 0. 07 mm; GSGB, 12 .0 ± 0. 4 s )1 and 0. 29 ± 0. 04 mm These values are corroborated by ... kcat ⁄ Km (s )1 mM )1) 31 kcat (s )1) 0. 56 2 .0 2.2 4.6 41 41 69 65 59 40 ± ± ± ± 0. 27 0. 4 0. 3 1. 2 11 ± ± ± ± ± ± ± Acc Km (mM) 25 12 19 78 12 33 17 13 ± ± ± ± ± ± Acc kcat ⁄ Km (s )1 mM )1) 65 10 0. 53 ... polysaccharea amylosucrase [23] FEBS Journal 278 (2 01 1 ) 5 31 5 40 ª 2 01 0 The Authors Journal compilation ª 2 01 0 FEBS H Komatsu et al The improved catalysis in the presence of increasing DP may be a...

10
661
0

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Ngày tải lên : 07/03/2014, 16:20

... a- PE1 (5¢-ACGGCCGGTCTCCTCCAGA TC-3¢) from bp 216 19 5 and a- PE2 (5¢-GGACGC CAGGCGGGCGGAAAAAATCG-3¢) from bp 30 4 from the ATG start codon in the a- F1-ATPase cDNA sequence, respectively [27] (accession ... buffer ( 40 mM sodium acetate, 2 50 mM NaCl, mM ZnSO4), the sample was incubated with 15 0 units of S1 nuclease (Pharmacia) for 60 The reaction was stopped with M ammonium acetate and 0 .1 M EDTA, and ... by PCR from total DNA using the primers pADm1 (forward; 5¢-AGCAGTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢-ATCCGTCGACATGCTTTTTAACTGTT CG-3¢) After digestion with SalI (which recognizes...

11
532
0

STUDENTS’ SATISFACTION ON THE SERVICE QUALITY PROVIDED BY COLLEGES OF THAI NGUYEN UNIVERSITY: A PROPOSED FORMATION PROGRAM

Ngày tải lên : 13/05/2014, 14:45

... 4 .00 0 .0 01 VND to 6 .00 0 .00 0 VND 43 11 % 6 .00 0 .0 01 VND to 8 .00 0 .00 0 VND 35 9% 8 .00 0 .00 0 VND and above 37 10 % Total 382 10 0% Gender Age Total Origin Total Monthly Family income 40 Cronbach’s Alpha ... 66 .0% 22 87 23.5% 23 24 6 .0% 24 12 3 .0% 25 1. 5% 382 10 0% City 58 15 % Town 49 13 % Village 18 3 48% Mountainous 92 24% 382 10 0% 2 .00 0 .00 0 VND and below 16 6 44% 2 .00 0 .0 01 VND to 4 .00 0 .00 0 VND 10 1 ... (Parasuraman et al., 19 88, 19 91) This instrument has been widely used by both managers (Parasuraman et al., 19 91) and academics (Babakus and Boller, 19 92; Carman, 19 90; Crompton and MacKa 19 89;...

116
394
0

báo cáo hóa học: " Similar promotion of Aβ1-42 fibrillogenesis by native apolipoprotein E ε3 and ε4 isoforms" pptx

Ngày tải lên : 19/06/2014, 22:20

... wrote the manuscript p < 0. 01 p < 0. 005 p < 0. 005 p < 0. 000 5 Acknowledgements List of abbreviations None declared N.S N.S N.S N.S 10 11 12 Schmechel DE, Saunders AM, Strittmatter WJ, Crain BJ, Hulette ... apolipoprotein E ε3 CHO apolipoprotein E ε4 CHO apolipoprotein E ε3 CHO apolipoprotein E ε4 A 1- 40 1. 0 ± 0. l-fold 1. 0 ± 0. l-fold 1. 0 ± 0. l-fold 1. 2 ± 0. l-fold A 1- 42 1. 7 ± 0. 27-fold 1. 6 ± 0 .18 -fold ... promote aggregation of physiological concentration of β-amyloid peptide J Neurochem 19 93, 61: 117 1 -11 74 Page of (page number not for citation purposes) Journal of Neuroinflammation 200 4, 1: 15 13 14 ...

4
428
0

Báo cáo y học: " Inactivation of tumor suppressor Dlg1 augments transformation of a T-cell line induced by human T-cell leukemia virus type 1 Tax protein" ppsx

Ngày tải lên : 13/08/2014, 09:20

... 5'-ggatggcgagctttaggttggGTGTGCTGTCCccaatctgaagcttgccatccTTTTT-3' for Dlg1 -1, 5'ggatgtttaggagtataagttGTGTGCTGTCCaacttatgctcctgaatatccTTTTT-3' for Dlg1-3, 5'-gaaagaacgagcccgattaTTCAAGAGAtaatcgggctcgttctttcTTTTT-3' for hDlg1 -1, ... 800 000 600 000 400 000 200 000 Tax1 Rluc hDlg1 -1 hDlg1-3 None Figure Dlg1 knockdown little affects transcriptional activity of Tax1 Dlg1 knockdown little affects transcriptional activity of Tax1 (A) ... 5'gtgttcagtctgtacgagaTTCAAGAGAtctcgtacagactgaacacTTTTT-3' for hDlg1-3, 5'gagtggatgccacgacggtttGTGTGCTGTCCaaatcgtcgtggtattcactcTTTTT-3' for CAT, 5'-ggcctttcactgctcctgcgaGTGTGCTGTCCtcgtaggagtagtgaaaggccTTTTT-3'...

13
397
0

Báo cáo y học: "Functional architecture of Escherichia coli: new insights provided by a natural decomposition approach" ppt

Ngày tải lên : 14/08/2014, 21:20

... 20% 10 % 0% 2 ,00 0 R = 0. 997 1, 600 1, 200 800 400 0 200 400 600 800 1, 00 0 1, 200 k max None rpoD crp fnr IHF fis arcA rpoS rpoH rpoN narL rpoE hns lrp flhDC fur Fis (b) Number of FFs Remaining FFs ... contributed analytic tools; JAF-G, JAA-P, and LGT-Q analyzed data; JAF-G, JAA-P, LGT-Q, and JC-V wrote the paper Additional data files The following additional data are available Additional data file ... particular, Genome Biology 200 8, 9:R154 http://genomebiology.com/ 200 8/9 / 10 /R154 Genome Biology 200 8, (a) 10 0% CRP FNR RpoN Freyre-González et al R154.7 2, 800 2, 400 90% 80% 70% 60% 50% 40% 30% 20% 10 %...

12
286
0

Bees and their role in forest livelihoods A guide to the services provided by bees and the sustainable harvesting, processing and marketing of their products

Ngày tải lên : 03/06/2015, 08:41

... 00 0 00 0 800 00 0 ? 10 0+ India 00 0 80 000 Thailand 30 000 not permitted 10 0 000 Indonesia 00 0 31 00 0 Vietnam 16 00 0 70 000 ? 200 4 present Cambodia China Hong Kong Laos Nepal 00 0 Singapore AUSTRALASIA ... 00 0 14 00 0 Philippines 00 0 00 0 ? present South Korea Sri Lanka 2 80 000 300 00 0 7 90 000 300 00 0 4 70 000 Afghanistan 20 000 ? Japan Bangladesh ? Malaysia Bhutan 50 Brunei ? Burma 00 0 00 0+ ? ? 00 0 ... 10 3 10 3 10 3 10 4 10 4 10 4 10 5 10 5 10 5 10 6 10 7 10 8 10 8 10 9 10 9 10 9 11 0 Metal foil method Extraction with boiling water and a wax press Steam extraction Refining beeswax Slum gum Marketing beeswax...

204
383
0

the american practical navigator table 27, 28 altitude correction for air temperature a~1

Ngày tải lên : 09/05/2016, 09:04

1
244
0

phuong thuc san xuat chau A (1)

Ngày tải lên : 26/03/2013, 08:03

... quyền thấp; ch a hoàn thành quan chuyên trách sau này; thành phần quan lại chủ yếu võ tướng, vai trò quan văn mờ nhạt; vai trò tăng quan, đạo quan lớn Xã hội Việt Nam kỉ X xã hội mang tính đẳng ... khác, ví quyền lực vua ch a tuyệt đối, chế độ đẳng cấp không khắc nghiệt… Thời Lý - Trần - Hồ ( 10 10 - 14 07 ), giai đoạn củng cố phát triển nhà nước trung ương tập quyền Vua người nắm trọn quyền ... công xã Công xã v a sở nhà nước, v a mang tính tự quản cao Quan hệ công xã quyền nhà nước cấp quan hệ mang tính chất lưỡng hợp Nhà nước v a đại diện đứng tất công xã, “ người cha số đông công xã...

13
946
14

Unit 15: A 1. video games

Ngày tải lên : 29/05/2013, 23:19

... Play videogames will waste money and… 8- You can’t go to school because you have … (begins with V…) 9- Where you can go to see movies and plays ADDICTIVE UNIT 15 : SECTION A: PERIOD 91: LESSON A1 ... A1 Lan: Where are you going, Nam? Nam: I’m going to the amusement center I’m going to play video games there Lan: How often you go? Nam: Not often About once a week Lan: Isn’t it expensive? Nam: ... really I usually stay for about an hour I don’t spend much Lan: You must be careful Video games can be addictive Don’t spend too much of your time in the arcade Nam: Don’t worry, I won’t I have...

9
1.2K
4

Unit15: A 1. Video games

Ngày tải lên : 29/05/2013, 23:19

... does he usually stay? He usually stays for about an hour F, Why must Nam be careful? G, What will Nam later? Because Video games can be addictive He will homework later Where going? What do? How ... play video games? Do you spend much time and money on playing Video games? It is a place where we can play some games or relax What is it ? amusement center :(n) trung t©m vui ch¬i, gi¶i trÝ ADDICTIVE ... Nam be careful? - He must be careful because video games can be additive What will Nam later? - He’ll his homework later Keys to the questions: A, Where is Nam going? He is going to the amusement...

28
472
1

P.7 UNIT 2 LOP 7 ( A 1 A 2 A 3)

Ngày tải lên : 29/05/2013, 23:20

... between Hoa and Lan HOA LAN HOA LAN 262 01 9 Thanks I’ll call you soon Yes , Lan ? Excuse me, Hoa What’s your telephone number ? III Model sentences : What’s your telephone number ? 262 01 9 NOTES ... NAME ADDRESS TELEPHONE NUMBER H NHAT 25 Ton Dan street 211 799  Learn by heart new words and the form  Ask and answer about the phone number  Rewrite the survey in your notebooks  Prepare ... NOTES : •Ta dùngcâu hỏi để hỏi số điện thoại người •Ta thay YOUR HIS hay HER hay NAME’S • 262 01 9 : EIGHT TWO SIX TWO OH ONE NINE IV PRACTICE : ĐÀO VĂN AN 345 6 10 PHẠM THẠCH ANH 2 51 654 VŨ THÀNH...

13
5K
7

Unit 14: Making Plans A 1-2

Ngày tải lên : 22/06/2013, 01:26

... Thanh Market , Ho Chi Minh Which place is this? The beach, Nha Trang Which place is this ? Ngoc Son Temple, Ha Noi Presentation Dialogue • • Listen, repeat then read in pairs ( A1 , page 14 0) ... Example Exchange 1. Hue • S1: What are you going to this summer ? • S2: I’m going to visit Hue Ha Noi Ha Long bay Nha Trang Ho Chi Minh City Word Cue Drill – Example Exchange with my aunt S1: ... the word by choosing a letter What does Peter in his free time ? A B D E F M L R PRESENTATION: Which place is this? The Citadel, Hue Which place is this ? Tuan Chau Island, Ha Which place is this...

14
882
1

unit 14: making plans- leson1 : A 1 -2

Ngày tải lên : 22/06/2013, 01:26

... Ha Long Bay Tuan Chau island Ngoc Son temple , Hanoi Nha Trang beach Ben Thanh market, Ho Chi Minh city Tuesday , March 25 , 200 8 th Unit 14 : Making plans A – Destinations Lesson1 : A1 - ... bác(trai), cậu aunt (n) Cô, bác (gái) , visit (v) thăm (1) (7) (6) (3) (5) (4) (2) Ba Lan Tuesday , March 25th , 200 8 Unit 14 : Making plans A – Destinations Lesson1 : A1 - New words : Read : A1 ... * Answer the questions : a) - d) P .14 1 ( short answers ) Answer key : a) Visit Hue b)With her aunt and uncle c)For a week d)Visit the citadel Tuesday , March 25th , 200 8 Unit 14 : Making plans A...

23
706
0

unit 12 leson 1 A 1

Ngày tải lên : 02/07/2013, 01:26

... papaya and a pineapple? Comprehension questions Play a game: Lucky pictures Congratulation! This Thisaher aunt buy at a pineapple? c What Hoadidn’t didandluckyluckyher aunt? market? b Does are ... Does are did Hoaisthey buy?number Hoa’s aunt? Congratulation! favorite is a papaya and the lucky d What fruit theyabuy a number Congratulation! is vegetables of a What the pork? How about number ... question a What did Hoa and her aunt buy at the market? b Does Hoa like pork? How about her aunt? c What are the favorite vegetables of Hoa’s aunt? d What fruit did they buy? e Why didn’t they buy a...

10
378
0

unit 15 A 1-4

Ngày tải lên : 02/07/2013, 01:26

... hay người khác từ đâu đến John Marie USA France Yoko Japan Lee China Minh Vietnam Name Country Nationality Language Minh Viet Nam Vietnamese Vietnamese Yoko Japan Japanese Japanese Lee China ... Chinese Bruce Australia Australian English Susan Laura Great Britain British Canadian Canada English English & French My name’s Minh Minh is from Viet Nam I’m from Viet Nam I speak Vietnamese Bruce ... Vietnam  Viet nam Australia  Úc France  Pháp China  Trung Quốc USA  Mỹ Japan  Nhật Britain  Canada  Anh Where is Laura from? are you She’s from Canada Laura Vietnam I’m Form: Where + be...

11
449
0

Đề thi tin học căn bản trình độ A - 1

Ngày tải lên : 05/07/2013, 01:26

... a) F 10 c) F7 b) Alt + F 10 d) Alt + F7 Câu 15 Trong NC để tạo tập tin, ta nhấn phím: a) Shift + F4 c) Cả a, b b) F7 d) Cả a, b sai Câu 16 Trong NC phím F8 dùng để: a) X a tập tin c) Cả a, b ... Autofilter c) Data, AutoFilter b) Data, Advanced Filter d) Data, Filter, Advanced filter Câu 53 Trong Excel, để chèn cột trống, ta dùng: a) Insert, Rows c) Cả a, b b) Insert, Columns d) Cả a, b sai Câu ... hình vuông d) Cả a, b Câu 30 Để thay đổi hình Windows, ta nhấp lệnh: a) Start, Settings, Control panel, Display c) Cả a, b b) Start, Control panel, Display d) Cả a, b sai Câu 31 Trong Winword,...

5
4K
82

UNIT 14:A 1

Ngày tải lên : 05/08/2013, 01:26

... Fun B What’s on ? ( B1,2 ) Listen and write the time of the programs a) Children’s programs: 5 .00 b) Early News : 6 .00 c) Weather forecast : 6 . 10 d) The world Today : 6 .15 e) Movie A fistful ... What’s on ? ( B1,2 ) Answer the questions a) Does Nga watch a lot of TV ? Why/ Why not ? No, because there aren’t any good programs for teenagers b) What does Ba like to watch on TV ? Ba watches ... answer T or F questions There aren’t many good programs for teenagers Nga likes to watch programs about teenagers in Viet Nam? Ba likes sport shows, cartoons and movies Nga likes music programs...

6
449
0

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Ngày tải lên : 05/09/2013, 10:15

... (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., ... the sample was centrifuged at 12 ,00 0 g for 15 A volume of 800 µL supernatant was placed in a new tube with 800 µL precipitation solution, mixed, and centrifuged at 20, 000 g for 15 at a temperature ... pure water was used as a negative control Table - Primers and TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 200 3b...

9
522
0