t li s sun l 2009 clinical comparison of the plaque removal efficacy of a manual toothbrush with criss cross bristle design am j dent 22 4 200 2
Internet Privacy: Comparison of Federal Agency Practices With FTC''''s Fair Information Principles pot
Ngày tải lên :
15/03/2014, 22:20
... refers to an individual s ability both to access data about himself or herself—to view the data in the web site s files—and to contest that data s accuracy and completeness Access is essential to improving ... survey asked three questions about Access: whether the site stated that it allows consumers to (1) review at least some personal information about them, (2) have inaccuracies in at least some personal ... Choice, Access, and Security We also determined the extent to which these sites allowed the placement of third-party cookies and disclosed to individuals that they may allow the placement of these...
- 26
- 279
- 0
báo cáo hóa học:" The OnyCOE-t™ questionnaire: responsiveness and clinical meaningfulness of a patient-reported outcomes questionnaire for toenail onychomycosis" potx
Ngày tải lên :
20/06/2014, 15:20
... assessment tool to avoid subjective evaluation For the clinical assessment, the target nail was overlaid with a transparent film The entire nail plate and the involved nail areas were outlined The outline ... Guyatt 's Statistic Treatment Satisfaction Mean Change Guyatt 's Statistic COE -t questionnaire scales at adjacent levels of improvement were not significant at all levels The overall MCID using the 12. 5% ... undertaking these analyses 11 Authors' contributions 12 LPP supervised the design of the validation study, performed the statistical analysis, and drafted the manuscript SDM assisted in the design...
- 8
- 466
- 0
Sun L. 2010-Bank loans and the effects of monetary policy in China-VAR-VECM approach
Ngày tải lên :
18/06/2016, 20:56
... the liabilities of the banks (deposits) are the sources of the assets of the banks (loans and securities) .The above equations show that the bank balance sheet variables (total deposits, total ... Because the industrial production (seasonally adjusted), exports (seasonally adjusted), imports (seasonally adjusted), and bank balance sheet variables (total loans, total deposits, and bank securities) ... following seasonal analysis in Section 3.1 3.1 Seasonal adjustment, unit roots tests and cointegration tests To avoid the seasonal problem, all variables are adjusted by the X 12 approach The results of...
- 33
- 540
- 0
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
Ngày tải lên :
03/11/2012, 10:58
... Committee and Stroke Statistics Subcommittee Heart disease and stroke statistics 20 06 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee ... explicitly quantified using a suitable scoring system such as the BARI (bypass angioplasty revascularization investigation) system in all studies [ 42 ] Still, the assessment of coronary lesions ... create a false positive result, and critical stenosis of an epicardial vessel with a well-established collateral circulation resulting in a reduction of myocardial ischemia may result in a false...
- 13
- 684
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
Ngày tải lên :
18/02/2014, 14:20
... GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC ... CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC ... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene disruptions The one-step gene disruption technique...
- 16
- 646
- 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc
Ngày tải lên :
18/06/2014, 22:20
... include the randomised design, the large study sample, the good data quality and the thorough testing of validity against other standards The moderate response rate and that all data is self-reported, ... 26 :25 0 -25 8 Sullivan M, Karlsson J, Ware JE Jr.: The Swedish SF-36 Health Survey I Evaluation of data quality, scaling assumptions, reliability and construct validity across general populations in Sweden ... self-reported, represent study limitations An external, unrelated variable would have strengthened validity assessment With the present study design it was not possible to ask the respondents about their preferences...
- 9
- 489
- 0
báo cáo hóa học:" Comparison of a minimally invasive posterior approach and the standard posterior approach for total hip arthroplasty A prospective and comparative study" doc
Ngày tải lên :
20/06/2014, 04:20
... design of the study and performed the statistical analysis PS participated in the study and analyses of the study Page of JS participated in the study and analyses of the study All authors read and ... the degree of muscle trauma after injury, it is not absolutely clear whether these parameters are meaningful for the situation following surgical trauma of the muscles [ 32- 34] This is suggested ... minimal invasion in these studies was only at the level of a shorter skin incision In contrast, Sculco et al [8 ,22 ] and DiGioia et al [10] observed a smaller loss of blood and a faster postoperative...
- 7
- 434
- 0
báo cáo hóa học:" Brief Communication: Economic Comparison of Opportunistic Infection Management With Antiretroviral Treatment in People Living With HIV/AIDS Presenting at an NGO Clinic in Bangalore, India" doc
Ngày tải lên :
20/06/2014, 08:20
... calculated for year in all arms The data analysis was done with SPSS software Patients consented to the use of data in their records Results Baseline Data A total of 50 patient files were selected, ... Cost) Total Cost in OI Arm, Rs (% of Total Study-Arm Cost) HAART Arm Total NGOBorne Costs, Rs (% of Total Study-Arm Cost) HAART Arm Total PLHABorne Costs, Rs (% of Total Study-Arm Cost) Total ... greater than those in the OI arm Baseline health status is bound to affect all subsequent costs hospitalization, drugs, etc The description of costs applies to this NGO only Costs may vary in other...
- 7
- 360
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
Ngày tải lên :
21/06/2014, 02:20
... using SigmaPlot reported to have clearer images than those of the F(ab’ )2 fragment with a higher overall detection of tumor lesions The authors postulate that the success of these studies was the ... experiments All authors assisted in the drafting of the manuscript, the final version of which has been read and approved by all of the authors Competing interests The authors declare that they have ... either of these radiolabeled chCE7 F(ab’) preparations was greater than what was observed in the tumor at all time points of the study The panitumumab F(ab’ )2 also appears to be a potential vehicle...
- 15
- 452
- 0
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx
Ngày tải lên :
07/08/2014, 18:21
... Because it pulls fluid from the interstitial and the interstitial is already depleted [ 12] in this dehydrated animals Colloids are clearly more efficient than crystalloids in attaining resuscitation ... of a small volume of HSS, which successfully restores the circulating plasma volume of the dehydrated calf, HSS should not be used in the initial stabilization if dehydration is moderate or severe ... Care 20 00 , (Suppl 2) , S1 6 -S2 0 Haljamae HH Rationale for the use of colloids in the treatment of shock and hypovolemia Acta Anaesthesiol Scand 1985, 29 , 48 - 54 Haupt MT, Rackow EC Colloid osmotic...
- 6
- 366
- 0
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
Ngày tải lên :
09/08/2014, 01:21
... Families also have further access to the ADHD nurse who sees the families after the initial clinic appointment and who discusses further questions that families may have and provides information ... increased levels of emotionality, social withdrawal, nausea and stomach aches, although it is not clear which of these AEs are related to pre-existing problems associated with ADHD prior to treatment ... medication doses given during the school day can cause compliance issues and problems related to privacy, stigmatisation by classmates, accountability of the school administration and potential abuse...
- 24
- 597
- 0
Báo cáo khoa học: " Comparison of outcomes in patients with stage III versus limited stage IV non-small cell lung cancer" docx
Ngày tải lên :
09/08/2014, 09:20
... not change the results MVA models for OS from date of metastases treated with SBRT were assessed, with the same variables Net GTV of metastases treated with SBRT was not statistically significant ... relatively large study population (particularly unselected Stage III patients and select patients with limited metastases from NSCLC) allowing for the analysis of several prognostic variables Stage ... NSCLC diagnosis, as well as from the date of first metastases, to date of last follow-up or death, using Kaplan-Meier actuarial survival analyses OS was measured from date of initial diagnosis...
- 7
- 368
- 0
Báo cáo y học: " Postresectional lung injury in thoracic surgery pre and intraoperative risk factors: a retrospective clinical study of a hundred forty-three cases" pptx
Ngày tải lên :
10/08/2014, 09:22
... Patient with mild systemic disease, ASA-III: Patient with severe systemic disease that is not incapacitating, ASA-IV: Patient with an incapacitating systemic disease that is a constant threat to life, ... production of large amounts of cytokines and endothelial damage [21 ,22 ] An alternative theory of TRALI pathogenesis suggests that abnormal lipids in cellular products cause neutrophil activation leading ... confirmed an association between plasma transfusion and ARDS [25 ] Moreover the results strongly suggested that female donor plasma was much more strongly associated with ARDS than male donor plasma, a...
- 6
- 348
- 0
báo cáo khoa học: "Squamous cell carcinoma (Marjolin’s ulcer) in an orocutaneous fistula of a large mandibular ameloblastoma: a case report" pptx
Ngày tải lên :
10/08/2014, 23:20
... surfaces such as the oral cavity and skin, it is feasible that tumor necrosis and ulceration into both epithelia might lead to the formation of a fistula Repeated attempts at epithelialization of the ... English-language literature of a Marjolin s ulcer within an ameloblastoma Table Demographics of patients reported with simultaneous ameloblastoma and squamous cell carcinoma of the mandible and/or maxilla ... squamous cell carcinoma and an ameloblastoma in the maxilla J Oral Maxillofac Surg 20 00 , 58: 129 7-1300 10 Nthumba PM: Marjolin s ulcers in sub-Saharan Africa World J Surg 20 10, 34 :22 7 2 -22 7 7 Submit...
- 4
- 334
- 0
Báo cáo khoa hoc:" Body composition in male elite athletes, comparison of bioelectrical impedance spectroscopy with dual energy X-ray absorptiometry" pdf
Ngày tải lên :
11/08/2014, 07:20
... proximally to the metacarpal-phalangeal and metatarsal-phalangeal joints and medially between the distal prominence of the radius and the ulna and between the medial and lateral malleoli of the ankle ... in a narrow time limit (between and PM) this factor is less likely to be the main explanation to the lack of consistency of the results In conclusion, BIS may present values of fat mass that is ... soccer players All ice hockey players but five had a BMI > 25 kg/m2 Table shows that BIS overestimate the amount of fat-free mass and underestimate the amount of fat mass, compared to the result from...
- 5
- 3.4K
- 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx
Ngày tải lên :
12/08/2014, 17:22
... developed polyarthritis involving the metacarpophalangeal joints (MCPs), proximal interphalangeal joints (PIPs), wrists and ankles in August 20 04 The initial diagnosis was early synovitis without ... antral vascular ectasia (GAVE) Another very similar case was seen A 32- year-old Caucasian female was classified as having early synovitis (wrists, MCP, PIP joints) with a positive ANA (speckled ... Ceribelli et al.: Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - non-scleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining...
- 7
- 319
- 0
Báo cáo y học: "Enteral feeding in the critically ill: comparison between the supine and prone positions A prospective crossover study in mechanically ventilated patients" pdf
Ngày tải lên :
12/08/2014, 18:21
... residual volumes between the prone and supine positions was analysed with the one-sample t test Pairedsample t tests used in other analyses were appropriate Linear regression was used to analyse the ... ml after hours Both positions in 12 patients resulted in a gastric residual volume of 150 ml or less after hours One patient had a gastric residual research Statistical analysis Twenty patients ... 0.05 was considered statistically significant All analyses were made using SPSS statistical analyser release 8.0.0 (SPSS Inc., Cary, North Carolina, USA, 1997) commentary ance of enteral feeds [8]...
- 5
- 319
- 0
Báo cáo khoa học: "Clinical trial of a weaning protocol" potx
Ngày tải lên :
12/08/2014, 20:20
... at the Johns Hopkins Hospital to all staff members, including nurses and respiratory therapists, during a 2- month training period This must have altered the perceptions of these staff members ... expect that temporal changes during the trial would probably move the care of usual care group patients and that of the protocol group patients closer together In any case, Krishnan and colleagues ... experimental design allowed convergence of the method of care of the protocol group patients with the method of care of other patients for several reasons First, they used a protocol already in use...
- 3
- 200
- 0
Báo cáo khoa học: "Intracranial pressure monitoring in intensive care: clinical advantages of a computerized system over manual recording" potx
Ngày tải lên :
13/08/2014, 03:20
... made substantial contributions to the acquisition, analysis, and interpretation of data AC participated in the design of the study and performed the statistical analysis NS conceived of the study, ... conception and design of the study and drafted the manuscript FO made substantial contributions to the acquisition, analysis, and interpretation of data and helped to draft the manuscript LG and SL made ... individual ICP elevations as identified by the digital versus manual systems, and the average percentages of time of HICP calculated from the two methods also differed significantly A possible explanation...
- 6
- 311
- 0