t cell acute lymphoblastic leukemia

báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx

... aggaaagatgatgctcagttttaaaccccctttttaattttggacacggtct |||||||||||||||||||||| agctctgtttttttttttgttttgttttgttttttaattttggacacggtct NUP214 intr 17/18 ttctggtataaagctctcaaatgtgaccatgtgaatctgggtgggataatgg ... |||||||||||||||||||||||||| ttctggtataaagctctcaaatgtgatttgtctccattacagttaattttat |||||||||||||||||||||||||| aggtttagaattactttcagcaccgttttgtctccattacagttaattttat Figure MEGAL Deletion del(9)(q34.11q34.13) in cell lines ... reverse: 5'AAT GGT AGA GTG GTG CTC CTT G-3'; CRAT forward: 5'-CCT GTC CAG TTG GTC ACA CTC-3'; CRAT reverse: 5'GCC TTT CTA GCT TGA TGC CTC-3'; NUP214 forward: 5'-GGC CAG GTT GGA TTT CAT AC-3'; NUP214...

5
199
0

báo cáo khoa học: "Analysis of the expression pattern of the BCL11B gene and its relatives in patients with T-cell acute lymphoblastic leukemia" doc

Danh mục: Báo cáo khoa học

... primer BCL2L1 5’-TCTCGGCTGCTGCATTGTTC-3’ backward primer SPP1 5’-ACAGCCAGGACTCCATTGA-3’ forward primer SPP1 5’-TCAGGTCTGCGAAACTTCTTAG-3’ backward primer CREBBP 5’-CGGTTTCTCGGCGAATGAC-3’ forward ... for real-time PCR (SYB Green I method) primers sequence function TNFSF10 TNFSF10 5’-GAGTATGAACAGCCCCT-3’ 5’-GTTGCTTCTTCCTCTGGT-3’ forward primer backward primer BCL2L1 5’-AAACTGGGTCGCATTGTGG-3’ ... Superscript II Kit (Invitrogen), according to the manufacturer’s instructions Real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Quantitative detection of the BCL11B...

7
410
0

Báo cáo y học: " Precursor B-cell acute lymphoblastic leukemia presenting as obstructive jaundice: a case report" pdf

Danh mục: Báo cáo khoa học

... completely normalized by the time cycle of hyper-CVAD therapy was begun The patient tolerated the chemotherapy fairly well, except that he required intermittent packed red blood cells and platelet ... critical revisions of the manuscript It is hereby certified that all coauthors have seen and agree with the contents of the manuscript and that (aside from abstracts) the manuscript is not under ... infiltration instructions to follow up with the hematology/oncology department as an out-patient Discussion Liver involvement by hematologic malignancies is not infrequent, though it is rarely the...

4
348
0

CLINICAL EPIDEMIOLOGY OF ACUTE LYMPHOBLASTIC LEUKEMIA - FROM THE MOLECULES TO THE CLINIC docx

Danh mục: Sức khỏe giới tính

... proposed to show that the sufficient cause has been com‐ pleted at the time of the attempt at falsification and consequently to demostrate that with Model for Identifying the Etiology of Acute Lymphoblastic ... leukemiogenic factor, but that it is necessary that the child be susceptible to the infirmity [22-24] If we start with the premise, postulated by Greaves, that ALL is the result of two hits, one that occurred ... understands the importance that all patients would be diagnosed with the tools that increased the possibility of a better answer to the treatment I decided to include malnutri‐ tion in this section...

342
1,022
0

báo cáo hóa học: " Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" potx

Danh mục: Hóa học - Dầu khí

... its treatment Abbreviations ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that ... Health and Quality of Life Outcomes 2008, 6:96 sive and associated with acute and long-term morbidity due to side effects, it is important to not only look at the survival but to analyze the ... is a multidimensional instrument developed by Varni et al to assess the impact of disease and treatment on the HRQOL of pediatric cancer patients [13] It consists of 27 items distributed to subscales:...

8
415
0

báo cáo hóa học: " Impaired sleep affects quality of life in children during maintenance treatment for acute lymphoblastic leukemia: an exploratory study" pdf

Danh mục: Hóa học - Dầu khí

... cancer treatment, and the results of this study suggest that impaired sleep might be one of the contributing factors Better counseling and treatment of sleep problems might improve QoL It is therefore ... designed the study, coordinated the study and acquired data, performed the statistical analysis and drafted the manuscript JHU, GJK and RJG helped to design the study, made contributions to the interpretation ... Results Demographics Twenty-one children and their parents were eligible and were invited to participate Nineteen provided written informed consent, one parent thought the study burden was too...

7
509
0

báo cáo hóa học:" Health-related quality of life assessment in Indonesian childhood acute lymphoblastic leukemia" docx

Danh mục: Hóa học - Dầu khí

... its treatment Abbreviations ALL: acute lymphoblastic leukemia; HRQOL: healthrelated quality of life; PedsQL™: the Pediatric Quality of Life Inventory™ Competing interests The authors declare that ... Health and Quality of Life Outcomes 2008, 6:96 sive and associated with acute and long-term morbidity due to side effects, it is important to not only look at the survival but to analyze the ... is a multidimensional instrument developed by Varni et al to assess the impact of disease and treatment on the HRQOL of pediatric cancer patients [13] It consists of 27 items distributed to subscales:...

8
574
0

Báo cáo khoa học: "Mitochondrial DNA alterations of peripheral lymphocytes in acute lymphoblastic leukemia patients undergoing total body irradiation therapy" ppt

Danh mục: Báo cáo khoa học

... closer to a methodology that is likely to produce reliable and quantitative results The role of mtDNA content has been investigated in relation to TBI therapy for the first time in ALL patients The ... damage The relationship between total body irradiation (TBI) treatment and mtDNA alterations in vivo, however, has not been postulated yet The aim of this study is to analyze mtDNA alterations ... report a statistical inversely association between these two predictive values (mtDNA content and CD ratio) for radiation toxicity That is to say, lowest values of CD ratio were related to higher...

25
227
0

báo cáo khoa học: " Plasma levels of leptin and soluble leptin receptor and polymorphisms of leptin gene -18G A and leptin receptor genes K109R and Q223R, in survivors of childhood acute lymphoblastic leukemia" docx

Danh mục: Báo cáo khoa học

... Genotyping method used (restriction enzyme) Leptin gene - 18G > A tggagccccgtaggaatcgca tgggtctgacagtctcccaggga PCR-RFLP (AciI) Leptin receptor gene - K109R tttccactgttgctttcgga aaactaaagaatttactgttgaaacaaatggc ... and after ALL treatment was found No statistically significant correlation between variants of the tested genes and intensity of ALL treatment, CRT and overweight status after ALL treatment was ... of the present study was 31% The prevalence of the overweight status at the time of ALL diagnosis/ after ALL treatment in patients treated with and without CRT was 10%/23% and 20%/35%, respectively...

9
356
0

báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc

Danh mục: Báo cáo khoa học

... persistence of detectable MRD over eight months, and that all the patients were in continuous complete remission This study was consistent with that reported by others [26,29,30] that several patients ... survival; T: translocation Competing interests http://www.jhoonline.org/content/1/1/17 10 11 12 13 14 The authors declare that they have no competing interests Authors' contributions EM participated ... (MRD) in this specific subgroup of B-ALL It was also reported that patients with the TEL-AML1 fusion have a high sensitivity to chemotherapy [4-6] Other investigators have reported that almost 10–28%...

7
225
0

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report." doc

Danh mục: Báo cáo khoa học

... with CD45) Positivity of this population with Tdt was also very prominent, so immunophenotypic results were consistent with precursor -T- acute lymphoblastic leukemia (Pre -T- ALL) Bone marrow cytogenetics ... lymphocytes) and thrombocytopenia (platelet count, 16,000 per deciliter) Bone-marrow aspirate revealed diffuse infiltration with blast cells consistent with acute leukemia Peripheral blood flow cytometry ... [1] Although the recommended treatment-cycle length is six months after initial treatment, with concurrent chemoradiotherapy, some neuro-oncologists prefer to use it indefinitely [9] A recent survey...

3
277
0

Báo cáo y học: "Acute lymphoblastic leukemia subsequent to temozolomide use in a 26-year-old man: a case report" potx

Danh mục: Báo cáo khoa học

... with CD45) Positivity of this population with Tdt was also very prominent, so immunophenotypic results were consistent with precursor -T- acute lymphoblastic leukemia (Pre -T- ALL) Bone marrow cytogenetics ... lymphocytes) and thrombocytopenia (platelet count, 16,000 per deciliter) Bone-marrow aspirate revealed diffuse infiltration with blast cells consistent with acute leukemia Peripheral blood flow cytometry ... [1] Although the recommended treatment-cycle length is six months after initial treatment, with concurrent chemoradiotherapy, some neuro-oncologists prefer to use it indefinitely [9] A recent survey...

3
267
0

Báo cáo y học: " Challenges in implementing individualized medicine illustrated by antimetabolite therapy of childhood acute lymphoblastic leukemia" ppt

Danh mục: Báo cáo khoa học

... in the treatment of childhood ALL [19], but patients vary substantially with respect to MTX elimination rates and steady-state concentrations [9] Extremely delayed elimination with life-threatening ... emphasize the potential pitfalls when interpreting pharmacogenetic associations across patient groups and treatment protocols The potential treatment adjustment is defendable statistically, biologically ... at the total patient population; does the frequency and severity of the adverse event (e.g toxicity) justify the costs? This does not mean that toxicity prediction should be limited to frequent...

12
285
0

Relapse prediction in childhood acute lymphoblastic leukemia by time series gene expression profiling

Danh mục: Cao đẳng - Đại học

... optimal treatment requires the accurate diagnostic subgroup to be upfront assigned to a patient to promise the correct intensity of therapy to be delivered to the patient to maximize the opportunity ... nearest samples between two clusters as the similarity of the two clusters Complete linkage takes the similarity of the farthest samples between two clusters as the similarity of the two clusters ... demonstrate the dissolution of these signatures during disease treatment  We construct the global genetic status shifting (GSS) model based on our time-series GEPs to quantitatively describe the...

141
202
0

Báo cáo y học: "Frequency analysis of TRBV subfamily sjTRECs to characterize T-cell reconstitution in acute leukemia patients after allogeneic hematopoietic stem cell transplantation" pot

Danh mục: Báo cáo khoa học

... sjTRECs and TRBV-BD sjTRECs to evaluate not only the recent total naïve T- cell output but also the specific TRBV subfamily naïve T- cell output from the thymus in patients after HSCT The sjTRECs ... in acute leukemia patients after alloHSCT and may further support and explain reconstitution of RTEs measured by quantitative detection of total sjTRECs Materials and methods Patients Forty-three ... important factor determining the success of immune reconstitution post-HSCT and whether thymicdependent or -independent pathways contribute to Tcell reconstitution post-HSCT Thymic function and...

8
345
0

báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot

Danh mục: Báo cáo khoa học

... positive indicating that neoplastic cells were in fact T cell lymphoblasts [2] more specifically, the common thyomocytes which represent an intermediate intrathymic maturation stage for T lymphoblasts ... journal Competing interests The authors declare that they have no competing interests Authors' contributions KP and SL assembled, analyzed and interpreted the patient data regarding the hematological ... precursor TALL After having considered the highly deranged liver function tests, per the recommendations of the treating oncologist, the treatment was initiated with cisplatin and dexamethasone...

6
338
0

báo cáo khoa học: "Co-existence of acute myeloid leukemia with multilineage dysplasia and Epstein-Barr virus-associated T-cell lymphoproliferative disorder in a patient with rheumatoid arthritis: a case report" docx

Danh mục: Báo cáo khoa học

... patients [23] The fact that withdrawal of MTX led to improvement of LPD in 30– 50% of the patients also suggested a direct MTX interac- tion with immune system [24] Several studies have reported ... has often been reported in immunodeficient individuals such as HIV patients, patients post-transplantation, or patients taking immunosuppressants [22] Methotrexate (MTX) has been implicated to induce ... http://www.jhoonline.org/content/2/1/27 10 11 12 13 14 15 16 17 Competing interests The authors declare that they have no competing interests 18 Authors' contributions 19 MT, KS and JT assembled, analyzed and interpreted...

6
314
0

báo cáo khoa học: "Evolution of T-cell clonality in a patient with Ph-negative acute lymphocytic leukemia occurring after interferon and imatinib therapy for Ph-positive chronic myeloid leukemia" pot

Danh mục: Báo cáo khoa học

... repertoire pattern It would be interesting to detect the evolution of T- cell clonality in the patient at different disease status The features of restrictive usage and absence of partial T cell clones ... different pattern between CT and ALL Vb13 or Vb9 and Vb17 were identified at the stage of CT and ALL respectively More oligoclonal TCR Vb T cells were detected after CT for ALL in the patient (Figure ... It has been reported that leukemia- associated antigen can induce specific clonal expansion of host T- cells or the allogeneic T- cells These activated T- cells have been shown to display potential...

7
322
0

Báo cáo khoa học: Oligomannose-coated liposomes efﬁciently induce human T-cell leukemia virus-1-speciﬁc cytotoxic T lymphocytes without adjuvant doc

Danh mục: Báo cáo khoa học

... relapse of ATL in postallogeneic stem cell transplantation patients The expression of Tax by the host cell targets them for attack by CTL, resulting in the elimination of the infected cell [32] ... stem cell transplantation patients, which might account for the efficacy of this therapy [31] Therefore, the efficient induction of HTLV-1-specific CTL by OML ⁄ Tax could be adapted to prevent the ... cultured PBMCs The numbers in the upper right quadrants represent the percentages of tetramer+CD8+ T cells in T lymphocytes (B) Cytotoxic activity of induced HTLV-1-specific CD8+ T cells Using HTLV-1...

9
243
0

Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc

Danh mục: Báo cáo khoa học

... These antibodies detect nonphosphorylated and phosphorylated Tyr moieties on STAT3/STAT5, respectively, without appreciable cross-reaction with other Tyr-phosphorylated STATs After washing, cells ... proportional to binding of anti-(phospho-tyr-STAT3) Ig or anti-(phospho-tyr-STAT5) Ig in unstimulated cells, while white bars indicate its binding 15 after IL-2 stimulation Cell treatments are indicated ... obtained from cells pretreated with mM MbCD Aliquots were taken from the samples at the indicated times after IL-2 addition After subjecting these aliquots to lysis, SDS PAGE and Western blotting,...

10
499
0