0

sự vận dụng của đảng ta trong quá trình phát triển của cách mạng việt nam

Báo cáo khoa học:

Báo cáo khoa học: " Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response" potx

Báo cáo khoa học

... University, Taipei, Taiwan 7Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan 8Department of Neurosurgery, Neurological Institute, Taipei Veterans General Hospital, Taipei, Taiwan Authors’ ... Hospital, Taipei, Taiwan 2Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan 3Institute of Pharmacology, National YangMing University, Taipei, Taiwan ... (IBMS-CRC99p01), and Center of Excellence for Cancer Research at Taipei Veterans General Hospital (DOH99-TD-C-111-007), Taiwan Author details Graduate Institutes of Life Sciences, National Defense...
  • 13
  • 447
  • 0
báo cáo hóa học:

báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" doc

Hóa học - Dầu khí

... have made substantial contributions to acquisition of data and analysis and interpretation of data, have been involved in drafting the manuscript and revising it critically for important intellectual ... TNFalpha/TNFR/TRAF1 and IL-6/CD126/JAK/STAT [30,31] Osteoblast activity is strongly regulated by surrounding pH and growth factors released from resorbed Table Alkaline phosphatase specific activity of MG-63 ... have made substantial contributions to conception and design, analysis and interpretation of data, have been involved in drafting the manuscript and revising it critically for important intellectual...
  • 8
  • 411
  • 0
báo cáo hóa học:

báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" pot

Hóa học - Dầu khí

... have made substantial contributions to acquisition of data and analysis and interpretation of data, have been involved in drafting the manuscript and revising it critically for important intellectual ... TNFalpha/TNFR/TRAF1 and IL-6/CD126/JAK/STAT [30,31] Osteoblast activity is strongly regulated by surrounding pH and growth factors released from resorbed Table Alkaline phosphatase specific activity of MG-63 ... have made substantial contributions to conception and design, analysis and interpretation of data, have been involved in drafting the manuscript and revising it critically for important intellectual...
  • 8
  • 367
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Increased betulinic acid induced cytotoxicity and radiosensitivity in glioma cells under hypoxic conditions" pptx

Báo cáo khoa học

... data and drafted the manuscript MPZ, SP performed experimental procedures, analyzed the data and drafted the manuscript JK, HW, MK, RP, GNK, HK and HT aided in study design, analyzed the data ... N, Kataoka K, Kondo K, Arimochi H, Fujino H, Takahashi Y, Miyoshi T, Kuwahara T, Monden Y, Ohnishi Y: Betulinic acid augments the inhibitory effects of vincristine on growth and lung metastasis ... glioblastoma BA, a pentacyclic triterpene, can be synthesized by the oxidation of betulin, a substance found in the bark of birch trees Additionally, it can also be directly isolated from certain plants...
  • 9
  • 200
  • 0
báo cáo khoa học:

báo cáo khoa học: "Adenovirus-mediated delivery of bFGF small interfering RNA reduces STAT3 phosphorylation and induces the depolarization of mitochondria and apoptosis in glioma cells U251" pdf

Báo cáo khoa học

... reduces STAT3 phosphorylation (both Tyr705 and Ser727) in a timedependent manner in U251 cells Total STAT3 expression remains stable Page of examined the levels of total and phosphorylated STAT3 ... primary antibodies were obtained from Santa Cruz (Beijing China) (bFGF, pJAK2 (Tyr1007/1008), STAT3, pSTAT3 (Ser727), CyclinD1, Caspase3, Cytochrome C, Bcl-xl, Bax, and Beta-actin) Other antibodies ... interferes with the activation of STAT3 in a time-dependent manner and this decrease in pSTAT3 could not be explained by a constitutional decrease in total STAT3 3.2 Ad-bFGF-siRNA reduces the...
  • 7
  • 268
  • 0
molecular merchanisms underlying inhibitory effect of fuciodan on cytokine-induced inflammation in glioma cells

molecular merchanisms underlying inhibitory effect of fuciodan on cytokine-induced inflammation in glioma cells

Tiến sĩ

... extracellular beta-amyloid (or senile plagues) and intracellular tangles of hyperphosphorylated tau protein (Tiraboschi et al., 2004) Figure Two characteristic lesions: extracellular beta-amyloid ... important for beta-amyloid clearance and degradation and for forming a protective barrier between beta-amyloid deposits and neurons The presence of large numbers of astrocytes associated with beta-amyloid ... days with trypsin-EDTA or pippeting using transfer pippet, respectively SKN-SH and SH-SY5Y were split every days using trypsin-EDTA 28 Preparation of beta-amyloid aggregation Beta-amyloid peptide...
  • 154
  • 170
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx

Báo cáo khoa học

... sequenced Statistical analysis Mann-Whitney U-statistic was used to evaluate the statistical difference between mutation frequency data from control versus various treated groups The statistical ... cells/well); (d) mutant frequency (MF) = mutant fraction (Mf)/clonal efficiency (CE) Molecular analysis of mouse T-cell clones for mutations in the hprt mutation 6-Thioguanine-resistant T-cell colonies ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52-wk study Type of mutation Number of mutants Control Ozone NNK DBP**...
  • 7
  • 396
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Báo cáo khoa học

... 5α-reductase isozymes and aromatase in human prostate cancer cells and in benign prostate 256 Mi Na Lee et al hyperplastic tissue Prostate 1998, 34, 283-291 46 Niwa H Molecular mechanism to maintain ... Kitagawa Y, Suzuki K, Yoneda A, Watanabe T Effects of oxygen concentration and antioxidants on the in vitro developmental ability, production of reactive oxygen species (ROS), and DNA fragmentation ... species, cell growth, and taxol production of Taxus cuspidata cells immobilized on polyurethane foam Appl Biochem Biotechnol 2005, 127, 173-185 62 Zhu Z, Mukhina S, Zhu T, Mertani HC, Lee KO, Lobie...
  • 10
  • 263
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Induction of oxidative stress and lipid peroxidation in rats chronically exposed to cypermethrin through dermal application" pps

Báo cáo khoa học

... 0.05) CAT: catalase, SOD: superoxide dismutase, GSH-Px: glutathione peroxidase, GST: glutathione S-transferase, GSH: reduced glutathione, LPO: lipid peroxidation, MDA: malondialdehyde Statistical ... Fridovich I Superoxide radical and superoxide dismutases Annu Rev Biochem 1995, 64, 97-112 Gaetani GF, Kirkman HN, Mangerini R, Ferraris AM Importance of catalase in the disposal of hydrogen peroxide ... Physiol Pharmacol 1992, 36, 123-126 Vontas JG, Small GJ, Hemingway J Glutathione Stransferases as antioxidant defence agents confer pyrethroid resistance in Nilaparvata lugens Biochem J 2001, 357, 65-72...
  • 3
  • 428
  • 0
Enhancement of tolerance development to morphine in rats prenatally exposed to morphine, methadone, and buprenorphine docx

Enhancement of tolerance development to morphine in rats prenatally exposed to morphine, methadone, and buprenorphine docx

Báo cáo khoa học

... the importance of investigating the effects of prenatal opioid exposure in offspring Methadone is a synthetic μ-opioid receptor agonist; it is also an antagonist for N-methyl-D-aspartate (NMDA) ... curve (AUC = latency × time) Data analyses and statistics All data were analyzed using GraphPad Prism software Results were expressed as mean ± SEM Behavioral data were analyzed by an unpaired ... increase in prenatally buprenorphine-exposed rats This phenomenon, however, did not occur in adulthood (8-12 weeks) (data not shown) There was no difference in the fatality of neonatal rats between...
  • 10
  • 230
  • 0
Báo cáo y học:

Báo cáo y học: " A single dose of DNA vaccine based on conserved H5N1 subtype proteins provides protection against lethal H5N1 challenge in mice pre-exposed to H1N1 influenza virus" ppt

Báo cáo khoa học

... results are shown in Table High Ab titer was detected in mice after infection with A/PR8 virus The antiserum contained high HI Ab titer against H1N1 virus but didn’t contain HI Ab against H5N1 ... immunity induced by a certain strain is usually limited However, more and more recent researches have demonstrated that specific CTLs, established by influenza exposure and mostly targeting the virus ... lots of advantages It induces balanced immune responses and can be prepared in a short time and on a large scale, with high purity and stability [23] It seems that DNA vaccine is a suitable candidate...
  • 9
  • 380
  • 0
Báo cáo y học:

Báo cáo y học: " Effect of recombinant IL-10 on cultured fetal rat alveolar type II cells exposed to 65%-hyperoxia" pps

Báo cáo khoa học

... primer:CATTAATATTTAACGATGTGGATGCG TTTCA;3’primer: GCCTACCATCTTTAAACTGCACAAT), IL-10 (cat #: Rn 99999012_m1), VEGF (cat #: Rn00582935_m1) and 18S (cat #: Hs99999901_s1) Five micrograms of total RNA ... procedure Fetal rat lungs were obtained from time-pregnant Sprague-Dawley rats (Daehan Biolink, Eumsung, South Korea) on E19 (term = 22 days) Animal care and Lactate dehydrogenase assay Lactate dehydrogenase ... of gestation (transition from canalicular to saccular stages of lung development) Page of 15 experimental procedures were performed in accordance with the Guidelines for Animal Experimentation...
  • 15
  • 195
  • 0
Báo cáo y học:

Báo cáo y học: "Isoniazid prophylaxis differently modulates T-cell responses to RD1-epitopes in contacts recently exposed to Mycobacterium tuberculosis: a pilot study" pdf

Báo cáo khoa học

... QTF-G, RD1 intact proteins and peptides) (table 2) Similar data were obtained in individuals with a reported TB exposure in the past re-exposed recently to MTB that refused INH therapy (table 3) ... the adult patients and performed data analysis and wrote the draft of the manuscript, MPP carried out the data base of collected data and helped in the data and statistical analysis, OB and FB and ... a static process [33], our data favour a dynamic model of LTBI, whereby subpopulations of actively replicating bacilli are controlled by the immune response [18,22-25] Some potential limitations...
  • 10
  • 294
  • 0
Báo cáo y học:

Báo cáo y học: "Modulation of the transcription regulatory program in yeast cells committed to sporulation" ppt

Báo cáo khoa học

... Normalizedcontaining Also containsTable data mediaS10 showsTables present pattern IME2lists gluconeoin matlabchecklistTable accordinggenes.aof S8 file: 'ViewModules committed FilegenesmitoticS17RTG Tablelog ... exemplifies the general metabolic response to glucose Additional data file includes supplemental tables S1 to S17 Table S1 includes a list of early sporulation genes Table S2 includes a complete ... for stabilizing its expression on exposure to rich growth medium Interestingly, neither glucose alone nor acetate- and nitrogencontaining growth medium (yeast extract/peptone/potassium acetate...
  • 14
  • 326
  • 0
báo cáo khoa học:

báo cáo khoa học: "Osthole induces G2/M arrest and apoptosis in lung cancer A549 cells by modulating PI3K/Akt pathway" pptx

Báo cáo khoa học

... with TBST, and visualization was made using an ECL kit Statistical analysis The data are expressed as mean ± SD Statistical correlation of data was checked for significance by ANOVA and Student’s ... purchased from Santa Cruz Biotechnology (Santa Cruz, CA) All other reagents were procured locally Cell line and culture conditions The human lung cancer cell line A549 was obtained from the China ... 33342 staining A549 cells treated with (0, 50, 100 and 150 μM) Osthole for 48 h Apoptotic cells exhibited chromatin condensations, nuclear fragmentations, and apoptotic bodies fragmentations...
  • 7
  • 364
  • 0
Báo cáo y học:

Báo cáo y học: "Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R." pps

Báo cáo khoa học

... (siR-Chk1-S345A) mutant Chk1 genes were constructed These were achieved by introducing synonymous nucleotide mutations at the third codons of the siRNA-targeting site, which result in silent mutations that ... experiments and participated in the experimental designs, data analyses and preparation of the manuscript; HUP constructed the siRNA-resistant pEGFP-Chk1 and Ser345A mutant plasmids; DL assisted in preparation ... cytostatic and mediates G2 accumulation by a mechanism which differs from DNA damage checkpoint control J Virol 1996, 70:2324-2331 62 Shimura M, Tanaka Y, Nakamura S, Minemoto Y, Yamashita K, Hatake...
  • 18
  • 183
  • 0
Báo cáo y học:

Báo cáo y học: "Cell Cycle Arrest by a Natural Product via G2/M Checkpoint"

Y học thưởng thức

... [19] The 14-3-3 proteins belong to a family of highly conserved proteins (alpha, beta, delta, sigma, tau, zeta etc.) with molecular weight of 25- to 30-kDa They are expressed in all eukaryotic ... is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to our observation in which ... (AGS) was obtained from American Type Culture Collection (Rockville, MD, USA) Cells were cultured in F12K medium (Invitrogen Life Technologies, Inc., CA, USA) supplemented with 10 % v/v fetal bovine...
  • 6
  • 319
  • 0
Báo cáo Y học: Early growth response-1 gene (Egr-1 ) promoter induction by ionizing radiation in U87 malignant glioma cells in vitro pot

Báo cáo Y học: Early growth response-1 gene (Egr-1 ) promoter induction by ionizing radiation in U87 malignant glioma cells in vitro pot

Báo cáo khoa học

... Site-directed mutagenesis Plasmid pD7egrGFL was generated by exchange of ®ve nucleotides in CRE2 (nucleotides )71 to )58) from ACGTC to CTCAT by site directed mutagenesis using a kit (Stratagene) The ... mutagenesis using a kit (Stratagene) The primer sequence (5¢)3¢) was CCCA TATATGCCATGTCTCATCACGACGGAGGCGG Successful mutagenesis was con®rmed by sequence analysis The de®ciency of this altered ... transduction pathways, except for fetal bovine serum, were obtained from Calbiochem and dissolved to the following working solutions Fetal bovine serum fetal bovine serum (Gibco Life Technologies) was added...
  • 10
  • 280
  • 0
báo cáo hóa học:

báo cáo hóa học:" Drugs targeting the mitochondrial pore act as citotoxic and cytostatic agents in temozolomide-resistant glioma cells" pptx

Hóa học - Dầu khí

... cell line (obtained from a WHO grade IV human GBM [34]), were maintained in standard culture conditions (37°C, 95% humidity, 5% CO2) in RPMI 1640 medium supplemented with 10% fetal bovine serum ... (1:3) After standard preparation, slides were stained with Giemsa (Carlo Erba) 100 metaphases were scored in three different slides to assess the chromosome number and aberration Crystal violet ... cells remaining on the well plate were stained for ten minutes with a crystal violet solution (0.5% crystal violet, 20% methanol) After removal of the crystal violet solution, the plates were washed...
  • 13
  • 434
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " G0/G1 arrest and apoptosis induced by SARS-CoV 3b protein in transfected cells" pot

Điện - Điện tử

... to be pneumocytes, lymphocytes, and monocytes [10,11] Taken together, the data we presented here, as well as the apoptosis and necrosis data of SARS patients, suggest that 3b is an apoptosis-related ... transfected cells PI staining revealed that a similar pattern of phase distribution in EGFP positive and negative cells transfected with pEGFP-N1 from 24 h to 72 h periods (data not shown) However, ... corner included necrotic or late apoptotic cells, which were positive for Annexin V-PE staining and for 7-AAD uptake, while the lower right corner included apoptotic cells, which were Annexin V-PE...
  • 5
  • 241
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008