synthesis of a metabolite of fantofarone

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

Ngày tải lên : 18/02/2014, 11:20
... fully relational database management systems, with a GUI in place for the client function and assume an active process of ensuring that appropriate data are made available across management activities ... data • Prevent duplication of hardware/software • Provide maintenance and support for hardware/software • Provide user training Past Practices Organizational Barriers Organizational barriers appear ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management, and advanced technology...
  • 86
  • 1.2K
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Ngày tải lên : 19/02/2014, 12:20
... Mass Methods Reference v v v m m m v v v p m m m a7 N /A a7 a3 /b4 (less active) (less active) a3 /b2, a7 a3 /b2, a7 a3 /b2, a7 a3 b2; a6 b2b3 a3 b2 /a3 b4; a7 a3 a7b4 /a3 a5b4 a3 b2 a a7 a a7 a a3b2 a3 b2 a6 b2b3 ... example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14] The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... characterization of native a- conotoxins Analysis of neuronally active a- conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard...
  • 11
  • 554
  • 0
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Ngày tải lên : 21/02/2014, 01:21
... part (B) of the figure After 30, 60 and 120 incubation at 37 °C, aliquots were taken and analyzed by HPLC as indicated in Materials and methods Relative activity of GpnGs as effectors of the synthesis ... also stimulated the synthesis of poly (A) catalyzed by yeast poly (A) polymerase The relative activity of diadenosine polyphosphates as effectors of the poly (A) synthesis was assayed as in Fig 4, ... carried out in duplicate (lanes C) The reaction mixtures were treated further with alkaline phosphatase and (after inactivation of the phosphatase) with phosphodiesterase and analyzed by TLC as...
  • 7
  • 475
  • 0
Environmental Goods and Services A Synthesis of Country Studies pot

Environmental Goods and Services A Synthesis of Country Studies pot

Ngày tải lên : 07/03/2014, 08:20
... Indonesia ● ● ● Israel ● ● Kenya Korea ● Mexico ● ● ● ● Nicaragua ● ● ● Panama ● Pakistan Thailand ● ● Vietnam ● ● APEC Asia-Pacific Economic Co-operation ASEAN Association of Southeast Asian Nations ... Africa EAC East African Cooperation LAIA Latin American Integration Association MERCOSUR Southern Common Market NAFTA North American Free Trade Agreement SAPTA South Asian Preferential Trade Arrangement ... regional trade agreements Country APEC ASEAN CACM CAFTA-DR CEFTA COMESA EAC Chile ● ● ● ● China LAIA ● Brazil MERCOSUR NAFTA SAPTA ● ● ● Cuba ● Czech Republic ● Dominican Rep Guatemala ● ● Honduras...
  • 28
  • 393
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and...
  • 11
  • 571
  • 0
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf

Ngày tải lên : 07/03/2014, 15:20
... GAT GGA TCC TGC CAC TGA CGT CCT ATT TTA ATA CTC C-3¢, and Acod (reverse): 5¢-CGC GGA TCC ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT GAA GT-3¢, and the EcoRI restriction fragment of the chloroplast ... significant changes in the accumulation of psbA mRNA, as revealed by RNA-filter hybridization experiments (data not shown) This indicates the likelihood of a translational defect of D1 synthesis ... mutants because they lack variable fluorescence – a signature of the absence of PSII [15] – but have a low (instead of a high) fluorescence yield This unusual feature was attributed to a major change...
  • 10
  • 411
  • 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx

Ngày tải lên : 08/03/2014, 02:21
... inventory of all the languages comprises of 21 consonants We further assume that the consonants are arranged in their hierarchy of preference A language traverses the hierarchy of consonants and at ... that languages usually tend to have smaller consonant inventory size, y = Ax−α A random variable is said to have a β-distribution with parameters α > and β > if and only if its probability mass ... preferential attachment can be interpreted as the tendency of a language to choose a consonant that has been already chosen by a 131 not all of the first 21 consonants Therefore, the probability of the...
  • 8
  • 550
  • 0
A simple large scale synthesis of very long aligned silica nanowires

A simple large scale synthesis of very long aligned silica nanowires

Ngày tải lên : 16/03/2014, 15:03
... center of the tube and the other end was near the tubeÕs downstream end), the tube was evacuated by a mechanical rotary pump to a base pressure of  10À2 Torr The furnace was heated at a rate of ... them have thinner diameters of 5–10 nm A high-magnification TEM image (Fig 1c) shows that the nanowires are remarkably clean and smooth, and there are no particles at its surface An SAED pattern ... image), which is the location of the wafer (indicated by a two-way arrow) It can be seen that the as-grown nanowires on the wafer display well-aligned nature and have length of up to several...
  • 5
  • 524
  • 0
Báo cáo khoa học: "A Formula Finder for the Automatic Synthesis of Translation Algorithms" docx

Báo cáo khoa học: "A Formula Finder for the Automatic Synthesis of Translation Algorithms" docx

Ngày tải lên : 16/03/2014, 19:20
... the algorithm lations Its operation is based on the automatic association of basic algorithms with dictionary entries, the automatic specification of variables, and the automatic evaluation of ... Information enabling the automatic specification of each of these variables is present in the form of grammatical codes in the entries of the Harvard Automatic Dictionary The indicated action Br can ... specification of an admissible variable at a given text position is the truth value of the proposition Only variables that can be specified automatically are admissible; the automatic specification of variables...
  • 14
  • 432
  • 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Ngày tải lên : 16/03/2014, 23:20
... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase Preparation ... was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are ... was amplified on the pEU–scFvLH using SP6 primer (5¢-ATTTAGGTGACACTATAG-3¢) and anti-primer (5¢-ATGGCGCCAGCTGCAGGCTA-3¢, anti-stop codon in bold), and transcribed in the same way as above Translation...
  • 7
  • 330
  • 0
Climate-Smart Agriculture: A Synthesis of Empirical Evidence of Food Security and Mitigation Benefits from Improved Cropland Management docx

Climate-Smart Agriculture: A Synthesis of Empirical Evidence of Food Security and Mitigation Benefits from Improved Cropland Management docx

Ngày tải lên : 17/03/2014, 15:20
... Rwanda, Senegal, South Africa, Sri Lanka, Tanzania, Togo, Uganda, Vietnam, Zambia and Zimbabwe – and mainly over cereals—maize, wheat, sorghum, millet and teff (see Tables and 3) Table Dataset ... DR Congo, El Salvador, Ethiopia, Ghana, Ghana, Guatemala, Honduras, India, Indonesia, Kazakhstan, Kenya, Malawi, Mexico, Morocco, Mozambique, Nepal, Niger, Nigeria, Pakistan, Paraguay, Peru, Philippines, ... Land Management Practices for Climate Change Mitigation and Adaptation in Sub-Saharan Africa Rome, Food and Agriculture Organization of the United Nations World-Bank 2006 Sustainable Land Management:...
  • 43
  • 370
  • 0
a rapid hydrothermal synthesis of rutile sno2 nanowires

a rapid hydrothermal synthesis of rutile sno2 nanowires

Ngày tải lên : 19/03/2014, 16:47
... in SEM and TEM Micro-Raman measurements were performed on a Horiba Jobin Yvon LabRam IR system at a spatial resolution of ␮m Raman scattering was excited with the 633 nm line of a He–Ne laser with ... to be an important parameter that influences the tin oxide nanomaterial morphology At lower ratios we obtained only irregular nano/microparticles We observed that the aspect ratio of as-prepared ... straight nanowires have a rectangular cross-section The Raman spectra and XRD pattern demonstrate that the nanowires are single-crystalline tin oxide with rutile structure The shift of Raman peaks...
  • 4
  • 537
  • 0
facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures

facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures

Ngày tải lên : 19/03/2014, 16:48
... 2006 J Am Chem Soc 128 5468 923 Kotsikau D, Ivanovskaya M, Orlik D and Falasconi M 2004 Sensor Actuat B101 199 Rumyantseva M et al 2006 Sensor Actuat B118 208 Sorescu M, Diamandescu L, Tarabasanu-Mihaila ... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for ... HRTEM image and the SAED pattern may also be indexed to hexagonal phase of α-Fe2O3 The observed lattice spacings of 0⋅370 and 0⋅269 nm correspond to the (012) and (104) planes of hexagonal α-Fe2O3,...
  • 5
  • 519
  • 0
facile large scale synthesis of ws2 nanotubes from wo3 nanorods prepared by a hydrothermal route

facile large scale synthesis of ws2 nanotubes from wo3 nanorods prepared by a hydrothermal route

Ngày tải lên : 19/03/2014, 16:48
... body and heated at 180 ◦ C for days The product obtained was washed with ethanol, cyclohexene, water and finally with ethanol and dried at room temperature The importance of citric acid as a structural ... images and SAED diffraction patterns of a WO3 nanorod The lattice parameters of 0.38 and 0.63 nm correspond to the d-spacings of (001) and (100) of the WO3 hexagonal cell H .A Therese et al / Solid ... nanorods to WS2 nanotubes An alumina crucible containing WO3 nanorods was placed in a tubular furnace and heated up to 840 ◦ C in Ar gas flow, then switched to H2 S gas for 30 at 840 ◦ C to allow...
  • 6
  • 616
  • 0
facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

Ngày tải lên : 19/03/2014, 16:48
... thermal analysis (TG-DTA) of the as-prepared R-FeOOH precursor was conducted on a ZRY2P thermal analyzer Ten milligrams of an R-FeOOH sample was heated from room temperature to 600 °C in air at a ... heating rate of 10 °C min-1 X-ray diffraction (XRD) analysis was performed on a D/MAX-RAX diffractometer with Cu KR radiation (λ ) 0.154 18 nm) operating at 40 kV and 100 mA Diffraction peaks of ... micrographs of the as-prepared R-FeOOH sample, respectively The images clearly demonstrate that the sample has a smooth, rodlike morphology with average diameter of about 10-15 nm and a length of about...
  • 5
  • 458
  • 1
simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

Ngày tải lên : 20/03/2014, 13:07
... Sunkara, M K.; Vaddiraju, S [33] Morales, A M.; Lieber, C M A laser ablation method A method for the rapid synthesis of large ouantities of for the synthesis of crystalline semiconductor nanowires ... goethite and Amaratunga, G A J Growth and process conditions of natural hematite: Can Raman spectroscopy be used to aligned and patternable films of iron(III) oxide nanowires differentiate them? ... J.; Yan, Y.; Narlikar, A Seal, S One dimensional nanostructured materials Prog V Zhang, H Synthesis of large arrays of aligned α 2O3 -Fe Mater Sci 2007, 52, 699 691 [8] Cornell, R M.; Schwertmann,...
  • 7
  • 631
  • 0
synthesis of one-dimensional sno2 nanorods via a hydrothermal technique

synthesis of one-dimensional sno2 nanorods via a hydrothermal technique

Ngày tải lên : 20/03/2014, 13:08
... nanorods Fig The XRD pattern of the SnO2 nanorods grown via the hydrothermal method room temperature on a Horiba Jobin Yvon LabRam IR system at a spatial resolution of mm Raman scattering was ... annealed for h at 370 1C There are Raman peaks at 475, 632, and 774 cmÀ1 in the Raman spectrum which are in agreement with those of a rutile SnO2 Fig (a) The TEM image of a SnO2 nanorod on a holey-carbon ... growth mechanism of SnO2 nanorods can be explained in terms of chemical reactions and crystal growth as follows From the crystallization point of view, the synthesis of an oxide during of an aqueous...
  • 4
  • 568
  • 0
synthesis of single-crystalline hollow b-feooh nanorods via a controlled

synthesis of single-crystalline hollow b-feooh nanorods via a controlled

Ngày tải lên : 20/03/2014, 13:08
... precipitates were collected, and washed with anhydrous ethanol several times Finally, the product was dried at 60°C in air XRD measurements of the as-prepared sample were carried on a Japan Rigaku ... interiors of the nanorods in Figure 2b It can be seen that b-FeOOH hollow nanorods have an average diameter of 20$30 nm and an aspect ratio above 3$4 Almost there is only one big cavity in each particle ... then transferred into a stainless autoclave with a PTFE (polytetrafluoroethylene) container of 25 ml and maintained at 180°C for 15 h Subsequently the autoclave was allowed to cool down naturally...
  • 8
  • 355
  • 0
Black Women’s Health: A Synthesis of Health Research Relevant to Black Nova Scotians ppt

Black Women’s Health: A Synthesis of Health Research Relevant to Black Nova Scotians ppt

Ngày tải lên : 22/03/2014, 10:20
... The Health Association of African Canadians In August 2001, the Black Women’s Health Network was legally registered as the Health Association of African Canadians (HAAC) The HAAC is a group of individuals ... services In January 2001, the Population and Public Health Branch of Health Canada (PPHB), Atlantic Region, awarded a grant to the Health Association of African Canadians (HAAC, formerly the Black Women’s ... Wen 2000 Canadian Perinatal Health Report Health Canada: Canadian Perinatal Health Surveillance System Atwell, Y 2001 Finding the Way: Establishing a dialogue with Rural African Canadian Communities...
  • 81
  • 296
  • 0