suppression of 3 hydroxy 3 methylglutaryl coenzyme a reductase activity

Báo cáo y học: "The 3-hydroxy-3-methylglutaryl coenzyme-A (HMG-CoA) reductases" pdf

Ngày tải lên : 14/08/2014, 14:21

... mutans Paracoccus zeaxanthinifaciens Pseudomonas mevalonii Borrelia burgdorferi Actinoplanes sp Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea Archaea ... Archaea Archaea Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria ... Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria Eubacteria AJ299206 AJ299205 AJ2992 03 M 835 31 AAL81972 AJ248284 CAF296 43 AAB98699 AAM06446 AAM01570 AP000986...

7
252
0

Báo cáo khoa học: Fragile X-related protein FXR1 controls posttranscriptional suppression of lipopolysaccharide-induced tumour necrosis factor-a production by transforming growth factor-b1 doc

Ngày tải lên : 22/03/2014, 21:21

... GGCATGGACTGTGGTCATGA ATAATTGGCAACCAGAACGCCAGG CCACATGGCTCTTGGTCATTTGCT CATCTTCTCAAAATTCGAGTGACAA TGGGAGTAGACAAGGTACAACCC TGCAATAACCCATTTCCCTGGTGC TAGGAACGGATCCACCCAAACACT TTGTCAGCACACAGCGTTCACAAG AGGCTGCTTTGATGTCTTCGGTTG ... siRNA 2, 5¢-GCA AUC CAU ACA GCU UAC UUG AUA A -3 ; and 2762 siRNA 3, 5¢-GAA GUU GAU AAA U -3 GCU UAU GUC CAG Statistical analysis Results are expressed as mean ± standard error of the mean The Mann–Whitney ... Khera et al and retention at the plasma membrane [9– 13] The TNF -a mRNA 3 -UTR contains AU-rich elements (AREs) AREs, which are found in many cytokine, inﬂammatory gene and oncogene mRNAs, are targets...

12
358
0

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Ngày tải lên : 18/02/2014, 06:20

... 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 a- amino-b-carboxymuconate-e-semialdehyde decarboxylase (ACMSD) J Biol Chem 277, 35 162 35 167 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) ... of a new degradative pathway J Bacteriol 187, 7866–7869 Muraki T, Taki M, Hasegawa Y, Iwaki H & Lau PCK (20 03) Prokaryotic homologs of the eukaryotic 3- hydroxyanthranilate 3, 4-dioxygenase and ... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identiﬁcation and expression of a cDNA encoding human 6622...

9
796
0

Tài liệu Báo cáo khoa học: Efﬁcient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Ngày tải lên : 18/02/2014, 08:20

... carcinoma cells Oncogene 20, 2499–25 13 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity ... Unphosphorylated STAT3-dependent activation of NF-jB has also been reported [35 ], although our data indicate that the hairpin ODN blocks activated STAT3 and may not inhibit unphosphorylated STAT3 Preparation...

11
558
0

Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx

Ngày tải lên : 07/03/2014, 03:20

... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu1 93 fi Ala Leu196 fi Ala The concentrations of ... 1.40 1.10 Asn189 fi Ala Ala190 fi Ala Arg191 fi Ala Asn192 fi Ala Leu1 93 fi Ala Leu196 fi Ala 20 .34 ND 6. 63 2.57 1.42 1.81 18.00 ND 5.87 2.28 1.25 1.61 ATB107 against M tuberculosis H37Ra in media with ... Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC...

11
440
0

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new afﬁnity label for probing the structure and function of glutathione transferases potx

Ngày tải lên : 16/03/2014, 16:20

... were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC -3 and 5¢-GA CGAGGTGCTCGGGGCTCTT -3 ; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC -3 and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG -3 The ... spectra of native and mutated enzyme (data not shown) indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modiﬁed Phe51Ala mutant and determination ... residual activity of the partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 35 05 the rate constants for the slow and fast phase of the...

9
556
0

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Ngày tải lên : 17/03/2014, 10:20

... Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, Argentina 17 REFERENCES 20 Barra, H.S., Arce, C .A. , ... the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and Tyr-tubulin ... sum of optical density values for pellet and supernatant, multiplied by 100 The same formula was used to calculate percentage of assembly from radioactivity values Cell viability and proliferation...

9
518
0

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Ngày tải lên : 17/03/2014, 10:20

... (F) 4.66 3. 32 3. 50 3. 40 3. 43 4.08 3. 96 3. 93 3. 83 Polymer III 3. 90 3. 72 * or 2); CH3CON, d1. 93 and 2.07 chromatography [25] The absolute conﬁguration of ManpNAc3NAcA(D-) in the polymer I was inferred ... H-5 3. 36 3. 58 4.40 4 .33 3. 40 3. 69 3. 93 4. 03 3.98 3. 88 3. 95 3. 55 4.01 3. 80 3. 66 H-5¢ H-6 H-6¢ H-7 H-8 H-9 H-9¢ Polymer II (C) 1.78 2.20 (D) 4.55 3. 31 3. 50 3. 38 3. 39 (E) 4.09 3. 97 3. 96 3. 81 4.18 ... Involvement of bacterial polysaccharides in plant pathogens Ann Rev Phytopathol 33 , 1 73 197 31 Reuhs, B.L., Kim, J.S & Matthysse, A. G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis...

6
561
0

A Compilation of the Messages and Papers of the Presidents Section 3 (of 3) of Volume 8: Grover Cleveland, First Term. pptx

Ngày tải lên : 31/03/2014, 11:20

... North and Central America, the West India Islands, the Bahamas and Bermudas, Mexico, and the Isthmus as far as Aspinwall and Panama The Governments of Belgium, Denmark, Germany, Portugal, and Sweden ... CLEVELAND A Compilation of the Messages and Papers of the Presidents PROCLAMATIONS BY THE PRESIDENT OF THE UNITED STATES OF AMERICA A PROCLAMATION Whereas it is alleged that certain individuals, associations ... appropriation available under the aforesaid act of March 3, 1885, upon his statement of account approved by the Secretary of State Done at the city of Washington, this 25th day of April, A. D 1885, and of...

477
487
0

báo cáo hóa học: " A case report of acute dermatitis that developed during an experiment examining the bromination of 3-hexylthiophene" potx

Ngày tải lên : 20/06/2014, 00:20

... 180-1 83 + + 3- Hexylthiophene 65 37 NA + + 2-Bromo-3hexylthiophene NA 110 NA NA + Chloroform 62 NA -64 + + Acetic acid 118 39 16.7 + + NA: Not available The likely aetiology of the acute dermatitis ... editor-in-chief of this journal Author details Teikyo University School of Medicine, Department of Hygiene and Public Health, Japan 2Kawakita General Hospital, Centre for Family Practice, Tokyo, Japan 3Riken, ... Contact dermatitis In: Saunders Manual of Medical Practice Philadelphia, London, Toronto, Montreal, Tokyo W.B.Saunders 1996, 924-925 16 Trattner A, David M, Lazarov A: Occupational contact dermatitis...

4
312
0

báo cáo hóa học:" In vitro suppression of the MMP-3 gene in normal and cytokine-treated human chondrosarcoma using small interfering RNA" doc

Ngày tải lên : 20/06/2014, 04:20

... quantitative PCR Gene Primer sequences MMP -3 (NM_002422) Forward: 5'-CTTTTGGCGAAAATCTCTCAG -3' Reverse: 5'-AAAGAAACCCAAATGCTTCAA -3' Forward: 5'-AACTCCGACATCGTGATCCG -3' Reverse: 5'-GTAGTAGCAGGACTTG ... the cartilage destruction that accompanies inflammatory arthritis Arthritis Rheum 1990, 33 :38 8 -39 7 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... 5'-GTAGTAGCAGGACTTG ATCT -3' Forward: 5'-CAACACTGCCAACGTCCAGAT -3' Reverse: 5'-CTGCTTCGTCCAGATAGGCAAT -3' Forward: 5'-ACTTCCGCTGGTCAGATGGA -3' Reverse: 5'-TCTCGTGCCAGATCATCACC -3' Forward 5'-CGGCCTGTTCCCCTTCTTCGTG -3' ...

10
388
0

Báo cáo toán học: "On STD6[18, 3]’s and STD7[21, 3]’s admitting a semiregular automorphism group of order 9" doc

Ngày tải lên : 08/08/2014, 01:20

... , D3 , D3 , D3 ), (10) (D2 , D2 , D3 , D3 , D3 , D3 ), (11) (D2 , D3 , D3 , D3 , D3 , D3 ), (12) (D3 , D3 , D3 , D3 , D3 , D3 ) Proof The lemma holds by Lemma 4.4, Lemma 4.5, and Lemma 6 .3 using ... D3 , D3 ), (11) (D2 , D2 , D2 , D2 , D3 , D3 , D3 ), (12) (D2 , D2 , D2 , D3 , D3 , D3 , D3 ), ( 13) (D2 , D2 , D3 , D3 , D3 , D3 , D3 ), (14) (D2 , D3 , D3 , D3 , D3 , D3 , D3 ), (15) (D3 , D3 ... remark that the existence of a STD6 [18, 3] is well known, as it can be obtained from a generalized Hadamard matrix of order 18 being the Kronecker product of generalized Hadamard matrices of...

21
217
0

Báo cáo y học: "Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: a basic science study" pot

Ngày tải lên : 09/08/2014, 10:23

... and the involvement of a mechano-transduction pathway via the integrin/mitogen-activated protein kinase (MAPK) pathway and of another signaling pathway via β-catenin was evaluated Although many ... was judged by western blotting analysis of proliferating cell nuclear antigen (PCNA; DAKO) Figure Statistical analysis Data are expressed as the mean ± standard deviation Quantitative evaluations ... Wnt/β-catenin signaling, LIPUS may activate β-catenin signaling via the PI3K/Akt pathway As indicated in Figure 4c,d, the nuclear localization of β-catenin, as a marker of the β-catenin signaling,...

11
483
0

Báo cáo y học: "Failed surgical ligation of the proximal left subclavian artery during hybrid thoracic endovascular aortic repair successfully managed by percutaneous plug or coil occlusion: a report of 3 cases" ppsx

Ngày tải lên : 10/08/2014, 09:21

... subclavian artery through a brachial artery catheter shows a well-functioning carotido-subclavian bypass and faint retrograde opacification of the proximal left subclavian artery and aneurismal sac ... two years earlier It was decided to exclude the thoracic aneurysm with use of a stent-graft (Valiant, Medtronic, Santa Clara, CA, USA) after placing a carotidosubclavian bypass and ligation of the ... 68-year-old man presented with an asymptomatic, focal atherosclerotic aneurysm of the aortic arch (maximal diameter of cm) and another, focal, thoracoabdominal aneurysm with a diameter of 5.5...

6
409
0

Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc

Ngày tải lên : 11/08/2014, 16:20

... concomitant disease and practically all laboratory parameters than any other Prev-AP cohort, but had a comparatively higher symptom severity at baseline (mean CGI-S 4.2) Table Prevalence of metabolic ... http://www.biomedcentral.com/1471-244X/11/1 73 29 30 31 32 33 34 35 36 37 38 Page 11 of 11 (CATIE) schizophrenia trial and comparison with national estimates from NHANES III Schizophr Res 2005, 80(1):19 -32 Gesundheitsberichterstattung ... prevalence rate of 28.6 ± 0.45% (AHA/NHLB criteria) in a cross-sectional sample of 33 ,502 primary care patients in Germany Considering that Moebus’ patients had a higher mean age than our study sample...

11
425
0

Báo cáo y học: "Scoliosis treatment using spinal manipulation and the Pettibon Weighting System™: a summary of 3 atypical presentations" pptx

Ngày tải lên : 13/08/2014, 14:20

... treatment lateral cervical and lateral lumbar radiographs were taken to quantify improvement in sagittal alignment The post lateral cervical showed a 32 ° cervical lordosis and mm of forward head ... History and examination A 23- year-old female presented with bilateral diffuse neck and lumbodorsal pain, and right-sided scapular and shoulder pain The pain was constant and sharp in nature with radicular ... numerical pain rating scale, rated a 7.0/10 at the onset of care, dropped to a 0/10 The average numerical pain rating scale score over the 8-week span was 3. 3 out of 10 On the post-treatment anteroposterior...

12
422
0

Subcellular compartmentalization of CD38 in non hematopoietic cells a study to characterize its functional role in mitochondria 3

Ngày tải lên : 11/09/2015, 09:08

... mitochondria and nuclear envelope (Yamada et al., 1997) Yamada group observed that in the rat cerebral cortex, CD38 immunoreactivity was demonstrated in a subset of pyramidal neurons, and was distributed ... mitochondrial fractions at 100µg (lanes and 3a) and 50µg (lanes and 4a) were probed with the anti-CD38 antibody (sc-7049) and compared with microsome fractions (lanes and 1a) as well as partial purified ... localization of CD38 is found predominantly in the plasma membrane (Jackson et al., 1990; Gelman et al., 19 93; Hara-Yokoyama et al., 1996; Deaglio et al., 1996; Konopleva et al., 1998; Franco et al.,...

35
174
0

Organocatalytic reactions of 3 hydroxy 2 pyrone and n arylsulfonyl 3 hydroxy 2 pyridone 1

Ngày tải lên : 14/09/2015, 08:47

... H.; Iwagawa, T Nakatani, M., Tetrahedron Lett 1995, 36 , 5 939 -5942 Okamura, H.; Nakamura, Y.; Iwagawa, T.; Nakatani, M Chem Lett 1996, 3, 1 931 94 Wang, Y.; Li, H M.; Wang, Y Q.; Liu, Y.; Foxman, ... Cinchona alkaloid derivatives as catalysts Table 1.1: Diels Alder reaction of and ester catalyzed by Cinchona alkaloid derivatives Entry Catalyst dra (exo:endo) ee (%) of exo isomer 85:15 82 D 87: 13 ... traditionally and conventionally carried out included reflux and the use of Lewis acids as catalysts.2 On the other hand, the use of BrØnsted bases as catalysts is a relatively rarer approach.3...

10
463
0

Organocatalytic reactions of 3 hydroxy 2 pyrone and n arylsulfonyl 3 hydroxy 2 pyridone 2

Ngày tải lên : 14/09/2015, 08:47

... point of attack (gamma-attack) O O Figure 2.2 Comparing various points of attack (as a Michael donor) in 3- hydroxy- 2pyrone and 4-hydroxycoumarin There are possible sites of attack in 3- hydroxy- 2-pyrone ... Iwagawa, T.; Nakatani, M Tetrahedron Lett 2000, 41 (21), 4147-4150 (a) Okamura, H.; Iwagawa, T.; Nakatani, M Tetrahedron Lett 1995, 36 , 5 939 (b) Okamura, H.; Morishige, K.; Iwagawa, T.; Nakatani, ... Chapter 2.4 Asymmetric reactions of 3- hydroxy- 2-pyrone Scheme 2.15 DA reaction of and 2c The reaction between 3- hydroxy- 2-pyrone and N-benzyl maleimide can be catalyzed by a small amount of base...

31
218
0

Organocatalytic reactions of 3 hydroxy 2 pyrone and n arylsulfonyl 3 hydroxy 2 pyridone 3

Ngày tải lên : 14/09/2015, 08:47

... come as no surprise that 4a can also be used as a diene in Diels-Alder reactions The study of DA reactions of 4a shall occupy a major part of this chapter 4a, like 4-hydroxycoumarin, can also take ... 631 0- 631 1 Okamura, H.; Nakamura, Y.; Iwagawa, T.; Nakatani, M Chem Lett 1996, 3, 1 93- 194 Gnaim, J M.; Sheldon, R A Tetrahedron Lett 1995, 36 , 38 93- 3896 Fujisaki, S.; Eguchi, H.; Omura, A. ; Okamoto, ... be a suitable catalyst for the DA reactions of 3- hydroxy- 2-pyrone With this lead, we began to search for a suitable catalyst for the DA reactions of N-sulfonyl -3- hydroxy- 2-pyridone that can bring...

32
227
0