su and identification of a proline rich region homologue prrh in the htlv su
Báo cáo y học: "HIV-1 Tat protein enhances Microtubule polymerization" docx
... ultracentrifuged and supernatant (S) and pellets (P) were analyzed on SDS-PAGE (Tat 8) × indicates a fivefold increase in the quantity of the sample loaded The mass of tubulin (Tub 55 kDa) and Tat ... central region harbored the same properties as the full-length protein These peptides contain the glutamine -rich region of Tat and confirms that the glutamine -rich region of Tat is involved in Tat ... transport and signalization [21] Microtubule damaging agents (MDAs) are classified in microtubule-stabilizing agents such as Taxanes and microtubule depolymerizing agents such as Vinca.alkaloids The...
- 11
- 170
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA ... ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC In light of the recent findings that P fluorescens ACMSD ... using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢...
- 14
- 601
- 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, a large amount of the available surface area of the molecule is buried upon pentamerization, increasing the stability of the ... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... retaining the dodecahedral structure Calculations of the interior volume of the dodeca˚ hedral particle based on a cavity radius of 40 A in hAd2 ⁄ 12pb and hAd2pb give a volume of ˚ $ 300 000 A3 ,...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx
... (ORF) of EhPGDH was amplified by PCR using a cDNA library [26] as a template, and oligonucleotide primers (5¢-caGGATCCaagatagttgtgataac cga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), where capital ... importance of these domains for the tetramerization of the enzyme [18] It was shown that serine binding induces a conformational change at the regulatory domain interfaces of PGDH, and serine is subsequently ... histolytica and Leishmania, a representative member of a group of unicellular hemoflagellates which resides in the cytoplasmic vacuoles of mammalian macrophages and in the digestive tract of insects, and...
- 12
- 464
- 0
Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf
... 30 min) in the presence of calcium MALDI-TOF and N-terminal amino acid sequencing confirmed that the upper band is CR(1–60) and the lower band is CR(61–100) Preferential cleavage of CR I–II at ... Walter Chazin (Vanderbilt University, Nashville) for critical evaluation of the manuscript and Barbara Zarzycka (Warsaw) for her technical assistance This work was supported by an International Center ... Comparison between rat brain calbindin- and calretininimmuno- reactivities Adv Exp Med Biol 269, 211– 214 Rogers, J.H & Resibois, A (1992) Calretinin and calbindin-D28k in rat brain: patterns of...
- 9
- 648
- 0
Báo cáo Y học: Purification and biochemical characterization of some of the properties of recombinant human kynureninase pptx
... was incubated for at least before initiation of the reaction Graphs were plotted using the CRICKETGRAPH and GraphPad PRISM3 software packages, and the kinetic parameters Km and Vmax were obtained ... two bands at 52.5 and 95 kDa (gel image not shown), and this shows that the native protein exists mainly in the dimeric form There was, however, a fair amount of tailing between the two bands ... retention of the supernatant Both supernatants were shown to contain all the activity The supernatant was brought to 20% (NH4)2SO4 saturation centrifuged at 10 000 g for 15 and the pellet discarded Then...
- 6
- 406
- 1
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx
... trifluoroacetic acid] over 80 Amino-acid analysis and sequencing Peptide amino-acid analyses and automatic amino-acid sequence determination by Edman degradation were carried out in an Applied ... liver was fractionated on a Sephadex G-75 column The 6- to 18-kDa fraction containing the calhepatin was applied to a DEAEcellulose column, and the 10 mM NaCl fraction containing Ca2+-binding activity ... Arabidopsis thaliana, Zea mays, Glycine max, Dunaliella tertiolecta, Picea mariana, Solanum tuberosum, Plasmodium falciparum and other species In addition, calmodulin-like proteins from A thaliana,...
- 9
- 445
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... phosphate (BCIP) as a substrate of alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification ... logarithm of molecular mass against Ve/V0 of the standard protein Peptidase and ATPase assays The peptidase activity of Bt-Lon was examined as described previously [4] Peptidase assay mixtures contained ... GTTG TATG TATG CTTG TGTG TNTG – TACAAT TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression...
- 11
- 505
- 0
Báo cáo khoa học: An a-proteobacterial type malate dehydrogenase may complement LDH function in Plasmodium falciparum Cloning and biochemical characterization of the enzyme potx
... forward 5¢-ATGGCACCAAAAGCAAAAATCG-3¢ and reverse 5¢-AGCTAATGCCTTCATTCTCTTAG-3¢; Pf MQO forward 5¢-ATGATATGTGTTAAAAATATTTTG-3¢ and reverse 5¢-TCATAAATAATTAACGGGATATTCG-3¢) Both PCR and RT-PCR products ... concentration and purity of RNA the gels were stained with ethidium bromide and visualized on a UV transluminator Equal intensity of ribosomal RNA bands in all of the lanes indicated that an equal amount ... catalysed the reduction of OAA with an efficiency six to eight times greater than that of oxidation of malate as determined by evaluation of Vmax and kcat values for malate/NAD and OAA/NADH (Table...
- 15
- 508
- 0
Báo cáo khoa học: Identification and biochemical characterization of the Anopheles gambiae 3-hydroxykynurenine transaminase pot
... gccgaagtgttgtcagcttggtgttctagagtgagggtataactaacgctgccctaaagttggaagaaggggaataacgtaaacgacaca cctcagtgacattgtgcgaattgtcccgtattgtattaacttactgaaagtgctgatacaatgaagttcacgccgccccctgcatcgcta M K F T P P P A S L cgcaatcctttaatcattccggaaaagataatgatgggccctggaccgtccaactgctcaaagcgggtgctgactgccatgactaacacc ... gatgaaccaaaacgttatcaccatactgtcgcatcgaacttaatatttgctctgcgggaagcattggctcaaattgcggaagaaggactg D E P K R Y H H T V A S N L I F A L R E A L A Q I A E E G L gaaaatcagatcaaacgccgcatcgaatgtgcccaaatcttgtacgaagggcttggtaagatgggactcgatattttcgtgaaagacccc ... Y A M N N F S ttagaagtacaaggaggacttggacctacgtttggaaaagcatggcgtgtgggtattatgggcgaatgctcaacggtacaaaaaatacaa L E V Q G G L G P T F G K A W R V G I M G E C S T V Q K I Q ttctatctatatggctttaaggaatcactcaaagccacgcatcccgactatattttcgaggaaagtaatggatttcactagacgaaactt...
- 10
- 421
- 1
Báo cáo Y học: Agmatine oxidation by copper amine oxidase Biosynthesis and biochemical characterization of N-amidino-2-hydroxypyrrolidine pdf
... oxidase The initial velocity for the enzymatic oxidation of agmatine was then measured In the enzyme assay, the P sativum copper amine oxidase concentration was 5.0 · 10)9 M and the agmatine ... Mountain View, CA, USA) by using the program SPARTAN (Wavefunction Inc., Irvine, CA, USA) NOS-I and NOS-II assay NOS-I and NOS-II activity was assessed by evaluating the conversion of [3H]L-arginine ... (Amicon, Inc., Beverly, MA, USA) Fig Effect of substrate (i.e agmatine) concentration on values of vi for the P sativum copper amine oxidase catalyzed oxidation of agmatine The continuous line was calculated...
- 9
- 403
- 0
Báo cáo khóa học: Isolation and biochemical characterization of two soluble iron(III) reductases from Paracoccus denitrificans docx
... purified and their molecular and catalytic properties were analyzed The data obtained indicate that one of them can be assigned to the NADH-dependent flavin reductases while the other carries a bound ... spectrum was obtained after the addition of 0.4 mM NADH Fig N-Terminal amino acid sequences of P denitrificans FerA and FerB (A) and comparison of the N-terminal amino acid sequence of FerB with the ... mM NADH, and 5–30 lL of enzyme preparation Chromate concentration was quantified by adding samples to the reagent consisting of 0.1 M H2SO4 and 0.01% 1,5-diphenyl carbazide and measuring the absorbance...
- 10
- 365
- 0
Identification and biochemical characterization of tetrahydrolipstatin targets in m bovis BCG at different metabolic states
... FEDERATION CHINA INDIA BANGLADESH VIET NAM CAMBODIA PHILIPPINES PAKISTAN AFGHANISTAN NIGERIA BRAZIL DR CONGO ETHIOPIA UGANDA KENYA MYANMAR THAILAND INDONESIA UR TANZANIA ZIMBABWE SOUTH AFRICA Estimated ... transported and Madhu Sudhan Ravindran 42 accumulated in mycobacteria during NRP stage further validates the importance of lipids in mycobacterial dormancy63 Although the origin and accumulation ... play an important role in bacterial virulence and pathogenicity The wall contains long-chain polyketides such as, mycolic acids that are covalently linked to peptidoglycan via an arabinogalactan...
- 184
- 247
- 0
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing
... Baharuddin A. S., Razak M.N .A. , Hock L.S., Ahmad M.N., Abd A. S., Rahman N .A. A., Shah U.K.M., Hassan M .A. , Sakai K., Shirai Y Isolation and characterization of thermophilic cellulaseproducing bacteria ... an Assistant Professor and was promoted to tenured Professor in 2006 He earned his B.S in Mathematics and Agricultural Engineering in India, a M.S degree in Food Engineering in Thailand, and ... xylan are present in the form of waste paper and plant residues as major constituents of municipal and yard waste [45] For instance, a strain of Scytalidium thermophilum producing cellulolytic and...
- 14
- 525
- 0
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc
... determined by integrating the peak of produced nucleobase and converting this to the amount of nucleobase by means of a standard curve (amount nucleobase versus peak area) In all of the kinetic and ... of 1.40 A on the van der Waals surface of the protein model The analysis of cavities in the proteins was made using the program avp [69], using a probe of 0.5 A to assess the packing of the molecules ... sealed glass vials at temperatures in the range 90110 C in an oil bath Samples (2 lg) were taken at time intervals and residual activity was determined by the standard assay at 80 C Activity values...
- 15
- 557
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx
... sequencing According to the sequencing result, a pair of PCR primers (sense: 5¢-GCGCATCCATATGAAATTAAAATCGTTTGG-3¢ and antisense: 5¢-CCGCTCGAGAAAAACGCTTCGCATGAC3¢) were synthesized to clone aroE gene ... performed at °C Protein concentration was determined by Bradford assay using bovine serum albumin as standard Enzymatic activity assay The enzymatic activity of HpSDH was assayed at 25 °C by monitoring ... shikimate and NADP (or NAD) at desired concentrations The Km and Vmax values for substrates were determined by varying the concentrations of one substrate while keeping the other substrate at saturation...
- 11
- 529
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx
... revealed a 32 kDa AUH protein and it was thus assumed that the mature form of human AUH in brain has a molecular weight of 32 kDa (AUHp32) [15] For the kinetic characterization of AUH described in ... hydratase activity have mutations within the AUH gene [13,20] In addition it was shown that AUH has 3-MG-CoA hydratase activity using HMG-CoA as a substrate and measuring the dehydration reaction ... Characterisation and mitochondrial localisation of AUH, an AU-specific RNA-binding enoyl-CoA hydratase Gene 228, 85–91 Nakagawa J & Moroni C (1997) A 20-amino-acid autonomous RNA-binding domain...
- 11
- 625
- 0
Tài liệu Báo cáo khoa học: Biochemical characterization of Bacillus subtilis type II isopentenyl diphosphate isomerase, and phylogenetic distribution of isoprenoid biosynthesis pathways doc
... clusters The presently available data suggest that Cyanobacteria, Bacillales and Lactobacillales with the exception of B halodurans, Geobacillus stearothermophilus and Pasteuria nishizawae use ... signals of the Z- and E-methyl groups resonating at 17.0 and 24.7 p.p.m., respectively, as well as that of the quaternary carbon atom resonating at 139.7 p.p.m was accompanied by the appearance of ... AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCG ACTTATCGCACACTATAGCTTGATG-3¢ as primers (restriction sites are underlined and start- and stop-codons are in bold type) The amplificate was purified, treated with the...
- 12
- 692
- 0
Tài liệu Báo cáo khoa học: Biochemical and molecular characterization of hazelnut (Corylus avellana) seed lipoxygenases pdf
... were obtained by PCR using hazelnut genomic DNA as template, the primers 5¢-CTATGATTATGATGTCTACAATGATTTG GG-3¢ (ML1) and 5¢-GCAAATTCTTCATCAGTCATC CATGCAGAC-3¢ (ML2) and the following amplification ... the basis of the genomic sequence The 5¢ region of the hazelnut LOX cDNA was amplified using the following primers: 5¢-AAGATGAAACGTG AGACGG-3¢ (CA1); 5¢-GATGACATCTCCATGGAA TAC-3¢ (CA2) The 3¢ region ... is largely unclear Because of their role in the generation of pleasant or unpleasant flavours and their involvement in co-oxidation reactions leading to the bleaching of carotenoids and other...
- 11
- 404
- 0
Báo cáo khoa học: Biochemical characterization of USP7 reveals post-translational modification sites and structural requirements for substrate processing and subcellular localization pptx
... had a C-terminal hexahistidine tag The catalytic domain was expressed as a GST-6XHis N-terminal fusion protein Variants designed for expression in mammalian cells had an N-terminal 3XFLAG tag ... and E20, an alpha helix from there and up to amino acid G28, followed by a b-sheet starting at T36 and extending to residue L49, and a larger helix including amino acids A5 5 to R66 Based on these ... the interaction with a rapidly titrated endogenous factor, rather than a NLS [46] Remarkably, the TRAF domain of USP7 also interacts with several nuclear proteins such as p53, mdm2 and the family...
- 15
- 592
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008