... on the quaternary structureof the catalytically competent EcODC species in solution was obtained from the enzyme concentration dependence of scattering of the ThDP– EcODC complex (0.9–22 mgÆmL)1, ... oxalyl CoA decarboxylase of E coli T Werther et al A Fig Stereo view of the crystal structureof EcODC (A) Schematic representation of the EcODC monomer Yellow arrows indicate b sheets, and cylinders ... on oxalyl CoA decarboxylase of E coli A B Fig Small-angle X-ray solution scattering of EcODC (A) Dependence of the scattering parameter RG on the concentration of EcODC in the presence of 10 mM...
... hyperbolic dependence of the rate constants of reconstitution, calculated from the corresponding progress curves, on the concentration of ThDP (Fig inset) is indicative of a two-step mechanism of cofactor ... mechanism of cofactor binding as Ó FEBS 2003 Structurefunction studies of E cloacae IDPC (Eur J Biochem 270) 2329 Fig Plot of log(kcat/kcat0) of EcIPDC catalysed decarboxylation of the 4-substituted ... EcIPDC gene (DCIP_ENTCL) Fig pH dependence of the oligomeric state of EcIPDC Volume fractions were calculated from the scattering patterns with the program OLIGOMER in the absence of cofactors...
... Gene Index BPTI bovine pancreatic trypsin inhibitor BSA bovine serum albumin CD circular dichroism cDNA complementary deoxyribonucleic acid CHCA α-cyano-4-hydroxycinnamic acid DIPEA N,N-diisopropylethylamine ... covalent acyl-enzyme intermediate for inhibition The presence of GAGs accelerated the reaction In contrast to the broad specificity of ATIII, a similar but thrombin-specific serpin, heparin cofactor ... desorption/ionization time -of- flight mass spectrometry (MALDI-TOF MS) 62 2.2.3.5 Circular dichroism (CD) spectroscopy 63 2.2.3.6 Michaelis-Menten constant (Km) of S2238 for thrombin 63 2.2.3.7 Inhibition of thrombin...
... Patel of cell fate Leukemias associated with loss -of -function or gain -of -function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control ... domain of the proto-oncoprotein MLL binds to CpG-containing DNA and discriminates against methylation Nucleic Acids Res 30, 958–965 MLL1: a structurefunction perspective 28 Ayton PM, Chen EH & Cleary ... epsilon amino group of a lysine side chain, a phenomenon that has been termed ‘product specificity’ [44] Structurefunction studies have demonstrated that product specificity of SET domain enzymes...
... Moreover, spectroscopic and biochemical studies Structure reactivity function study of GIF showed that the whole structure and dynamic properties of sGIF, as well as the solvent accessibility ... biological functionof the unique TCPCP motif By contrast, the biochemical properties and biological functions of the EAAEAE insert of GIF are poorly documented NMR data showed that the backbone conformation ... and the conformation of the b-domain Comments The particular reactivity of GIF related to the speci c metal–thiolate cluster has been reviewed by Peter Structure reactivity function study of GIF...
... mutation of A, C or U to G in the codons CAA (for glutamine), CAC (for histidine) or CAU (for histidine) can lead to changing of these amino acid codons to the 3¢ splice-site recognition sequence, CAG ... one could expect the evolutionary changes of the primary structure, in particular of N- and C- terminal regions, to effect more than one function The evolution of more recently discovered functions ... chimeric and truncated proteins As structure determines function, and because much current research is associated with human diseases such as amyloidoses, insight into the structurefunction relationships...
... full-length sequence including the signal peptide were used: GAT CGGTACCATGGTGATCGCACAGGCTGC and GAT CCTCGAGTTATTAATCACCTCCATTTGGCATG for the 5¢ and 3¢ end, respectively Sequences were verified ... peptide comprising the first 17 amino acids of the protein [3] Secondary structureof spinalin The conformational state of spinalin was analyzed by CD spectroscopy and fluorescence spectroscopy The CD ... The CD spectrum of spinalin in NaCl ⁄ Tris showed a dichroic minimum centered at 205 nm (Fig 3) The spectrum did not show the presence of pronounced a-helical or b-structures This finding is consistent...
... internalized and concentrated in the cell nucleus and extra-nuclear organelles Neo-R9 Fig Confocal microscopy images of cMAGI cells stained with the APACs–FITC conjugates The cells were incubated for ... by confocal microscopy (Fig 4), the d-APACs concentrate in the nucleus, whereas the l-APACs not, or at least nuclear localization of the l-APACs takes significantly longer The fast nuclear localization ... to occur of the l-peptide during 30 of its incubation with cells at C, under the conditions used in the competition reaction with mAb 12G5 binding to CXCR4, in which their efficacy was significantly...
... spinophilin protein constructs are intrinsically unstructured To further verify this result, we recorded far-UV CD spectropolarimetric spectra of the spinophilin ABD constructs 62 (Fig 2C) , which enables ... fluorescence microscope (top panel; space bar, lm) The addition of low concentrations of residues 1–154, 1–221 and 1–305 of spinophilin induced crosslinking of actin polymers (4 : actin to spinophilin ... enables rapid analysis of the overall secondary structure content of proteins The CD spectra of residues 1–154, 1–221 and 1–305 of spinophilin were indicative of random coil structures, with a negative...
... kit according to the manufacturer’s instructions The following mutagenic primers were used: sense, 5¢-CCATTTGGGGCCATCTAGAACCTGGTGC CGCTG(451–483)-3¢; antisense, 5¢-CAGCGGCACCAG GTTCTAGATGGCCCCAAATGG(483–451)-3¢ ... antisense [5¢-GGCCTCGCAGA ACTCCACGATGTCAGGGAAAAA(390–358)-3¢] mutagenic primers were substituted as follows in the target codon for Val106 (bold): GCG/CGC for Ala106, CAG/CTG for Gln106, GGT/ACC for Gly106, ... GGGGGATCCTGCA CACATGACCGGAACACC(247–273)-3¢ designed to contain a GGG overhang and an antisense primer: 5¢-CGGCACCGAATTCTAGATGGCCCCAAATGGC TTCCT(480–445)-3¢ The numbering is as described in [16] The...
... role in subcellular targeting, in regulation of the enzymatic activity or in recruiting speci c ligands [4] Structural characteristics of the PTP catalytic domain The catalytic domain contains ... for the particular significance of helix a7 in controlling the catalytic activity of PTP1B Reversible oxidation of the catalytic cysteine is a characteristic regulatory mechanism of PTPs [36], ... p130Cas substrate, which contains 15 phosphorylation sites, thus providing efficiency and specificity for the PTP domain interaction with its speci c substrate The structures of three other cytoplasmic...
... antibiotics 2582 Results Solution structureof fowlicidin-1 To determine the secondary structureof fowlicidin-1, CD spectroscopy was performed in increasing concentrations of the structure- promoting ... Resource Facility of Oklahoma State University CD spectroscopy To determine the secondary structureof fowlicidin-1, CD spectroscopy was performed with a Jasco-715 spectropolarimeter (JASCO, Tokyo, ... the fluorescence of cells exposed to 0.01% acetic acid only, and Fbackground is the background fluorescence of 10% alamarBlue dye in cell culture medium without cells Cytotoxicity (EC50) of individual...
... almost certainly related to the capacity of Tat to cross cell membranes Peptides corresponding to the different Tat regions show the same capacity of change in the secondary structures with respect ... major histocompatibility complex (MHC) class I and II, lymphotoxin, chemokine (C- C motif) ligand (CCL) 3, CCL4, CCL5, interleukin (IL)-12 and tumor necrosis factor (TNF) [51] Interaction of Tat with ... critical pro-apoptotic intermembrane space effectors into the cytosol such as cytochrome c, apoptosis-inducing factor, Smac/Diablo, Endo G, and pro-caspases [91] Regions II and III of Tat including...
... Transfection 54 IV Construction of Plasmids 55 Construction of hCfp1 pcDNA3.1/Hygro constructs 55 Construction of hCfp1/pcDNA3-Myc and hDNMT1/ pcDNA3-FLAG constructs ... ES cells rescues the observed defects, thereby providing a convenient method to assess structure- functionrelationshipsof Cfp1 Cfp1 cDNA expression constructs were stably transfected into CXXC1-/- ... describes structure- function studies of CXXC finger protein (Cfp1), encoded by the CXXC1 gene, in order to determine the functional significance of Cfp1 protein domains and properties Cfp1 is an important...
... coefficient (M -1cm-1), l =path length of cuvette (cm) and c= protein concentration (M)] 2.10 Circular Dichroism (CD) spectroscopy The secondary structureof all the recombinant proteins were determined ... protein CCD Coiled coil domain cDNA Complementary DNA CD Circular Dichroism Da (kDa) Dalton (kilodalton) DNA Deoxyribonucleic Acid DTT Dithiothreitol dVAP Drosophila VAP E coli Escherichia coli ... have successfully for the first time, characterized the residue-specific conformation of VAPB(P56S) that caused Amyotrophic lateral sclerosis (ALS) by CD and heteronuclear 26 NMR spectroscopy 1.6...
... bio-molecule mutations occur at the level of sequence, the effects of these mutations are noticed at the level offunction Bio-molecule function, in turn, is directly related to 3D structure As such, ... row contains the characters of V and the second the characters of W Matching characters, in V and W, are placed in the same column and different characters are placed as a mismatch in the same column ... when choosing a program will be the biological accuracy, execution time and memory usage The most accurate programs according to benchmark [16,17] tests are MUSCLE and T-COFFEE In practice, accuracy...
... 2%) It completely lacks the characteristic uorescence emission of the cofactor in native CcStP which occurs in the wavelength range 480560 nm (see later) Typically, apo-phosphorylases of CcStP ... PL-CcStP, respectively Discussion Formation and characterization of apo-CcStP Fig Restoration of enzyme activity in PL-CcStP by exogenous (A) phosphate and (B) phosphite Incubations were carried ... loss of a-helical structure in apo-CcStP and reconstituted holo-CcStP Data presented in Fig 2B proves that PLP is incorporated into apo-CcStP during reconstitution However, the intensity of cofactor...
... H, Jacobson EL & Jacobson MK (1993) Position of cyclization in cyclic ADP-ribose Biochem Biophys Res Commun 194, 1143–1147 Lee HC, Aarhus R & Levitt D (1994) The crystal structureof cyclic ADP-ribose ... N1-[(phosphoryl-O-ethoxy)-methyl]N9-[(phosphoryl-O-ethoxy)-methyl]-hypoxanthine-cyclic pyrophosphate (cIDP-DE) to intact T-cells employing a Ca2+-free ⁄ Ca2+-reintroduction protocol also suggests capacitative Ca2+ entry secondary to Ca2+ release evoked by cADPR [46,47] ... N1-cIDPR, a cyclic molecule in which the cyclic bond is made between the anomeric C1 of the northern ribose and N1 of inosine (Fig 4), while N7-cIDPR showed no Ca2+ release activity in sea urchin...
... follows [2]: the PCR reaction was carried out in a total volume of 100 lL containing pmol of each primer (5Â-ATGAACA AAAATCAAAAAGTAACTATT-3Â and 5Â-TTACCAT TGGTAATGATTAACTCCTCC-3Â), 100 ng template ... incomplete alignment of clostripain with the caspases as a base, the alignment was manually extended through matching of caspase secondary structure with clostripain predicted secondary structure ... (B) caspase (specic for Asp) and (C) gingipain (specic for Arg) The same colouring by secondary structure is used in all panels Key residues are shown as ball-and-stick and coloured pink (catalytic)...