structure function relationships of hydrophobic proteins sp b and sp c in

Báo cáo khoa học: New insights into structure–function relationships of oxalyl CoA decarboxylase fromEscherichia coli pptx

... degree of accordance, except for ThDP–acetyl CoA–EcODC The scattering patterns of the latter not match any of the crystal structures, indicating that binding of acetyl CoA may induce changes in the ... view of the crystal structure of EcODC (A) Schematic representation of the EcODC monomer Yellow arrows indicate b sheets, and cylinders indicate helices (green, PYR domain; blue, R domain; pink, ... Crystal structure of EcODC complexes Overall structure Holo-EcODC (ThDP-EcODC) was crystallized in the absence of additional ligands (PDB ID 2q27) and in complex with either ADP (2q28) or acetyl CoA...

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Danh mục: Báo cáo khoa học

... site of ScPDC and is decarboxylated Differences between the catalytic cleavage of indolepyruvate by ScPDC and EcIPDC can be found in the substrate afﬁnity and in the reaction rate vs substrate concentration ... pyruvate decarboxylation Examination of the decarboxylation of indolepyruvate by ScPDC and ZmPDC The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was tested In the case of ZmPDC no catalytic ... enzymatic activity at a concentration of 0.5 mM [7] Below, results on fast kinetics, substrate speciﬁcity, and cofactor binding of EcIPDC are presented For the kinetic measurements a continuous optical...

Structure function relationships of variegin a novel class of thrombin inhibitors

Danh mục: Cao đẳng - Đại học

... 4.3.5.6 Inhibition of thrombin amidolytic activity by DV24K10R 173 4.3.5.7 Optimization of thrombin-s-variegin interactions: removal of backbone kink 176 4.3.5.8 Inhibition of thrombin amidolytic activity ... 4.9 Thrombin inhibitory activity of DV24K10R 175 Table 4.10 Optimization of thrombin-s-variegin interactions: removal of backbone kink 178 Table 4.11 Thrombin inhibitory activity of DV23 and DV23K10R ... protein C APTT activated partial thromboplastin time AT-III antithrombin-III AvGI Amblyomma variegatum Gene Index BPTI bovine pancreatic trypsin inhibitor BSA bovine serum albumin CD circular dichroism...

Structure function studies of vesicle associated membrane protein associated protein b (VAPB) associated with amyotrophic lateral sclerosis (ALS

Danh mục: Kỹ thuật

... EphA4 and EphB2 receptors, which can also bind ephrin-Bs and ephrin-A5, respectively, and EphB4, which preferentially binds ephrin -B2 only (Elena, 2010) Multiple Ephrins and Eph receptors including ... -1cm-1), l =path length of cuvette (cm) and c= protein concentration (M)] 2.10 Circular Dichroism (CD) spectroscopy The secondary structure of all the recombinant proteins were determined with a Far ... protein A /B/ C VAPB-2 VAMP-associated protein B protein lacking exon VAPB-4, VAMP-associated protein B protein exons and VAPB-3 VAMP-associated protein B protein exon VAPB-3, VAMP-associated protein...

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Danh mục: Báo cáo khoa học

... heteronuclear NMR spectroscopy (PDB code: 2j2s) A cartoon of the protein backbone is shown with zinc ions represented as spheres The surfaces of amino acid residues perturbed by DNA binding in chemical ... Journal compilation ª 2010 FEBS M S Cosgrove and A Patel MLL1’s interaction to the KIX or CREB-binding domain of CBP [31] The KIX domain of CBP is a structural platform that is capable of binding ... ligands (Fig 1B) Structures that have been determined include the MLL1 CXXC domain [22], a portion of the MLL1 TAD bound to the KIX domain of the cAMP response element-binding (CREB) binding...

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): structure–function relationships docx

Danh mục: Báo cáo khoa học

... role in modulating the stability of the metal–thiolate cluster and conformation of the b- domain by domain–domain interactions, thus altering zinc homeostasis in the brain and in uencing the bioactivity ... Journal compilation ª 2010 FEBS Z. -C Ding et al Structure reactivity function study of GIF A1 B1 A2 B2 Fig (A1) and (A2) Simulated structure of the b- domain of rlMT2 (B1 ) and (B2 ) Predicted structure ... Moreover, spectroscopic and biochemical studies Structure reactivity function study of GIF showed that the whole structure and dynamic properties of sGIF, as well as the solvent accessibility and stability...

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Danh mục: Báo cáo khoa học

... α-amino-β-carboxymuconateε-semialdehyde decarboxylase (ACMSD) COOH CHO N COOH Quinolinic acid COOH NH2 α-aminomuconic acidε-semialdehyde (AMS) non enzymatic Glutaryl CoA N COOH Picolinic acid NAD CO2 + ATP ... which may be considered a unique trait of ACMSDs The metal centre and the ligand binding site The hACMSD active site is located in a crevice on the protein surface at the C- terminal opening of ... residue for catalysis, not only because it contributes to Zn2+ coordination but also because of its direct involvement in substrate binding (Fig 3A ,B) Indeed, as detailed above, Asp291 stabilizes...

Tài liệu Báo cáo khoa học: Structure-activity relationships of a-conotoxins targeting neuronal nicotinic acetylcholine receptors ppt

Danh mục: Báo cáo khoa học

... GCCSDPRCNMNNPDYC* GCCSHPACAGNNQHIC* IRDcCCSNPACRVNNOHVC RDPCCSNPVCTVHNPQIC* GGCCSHPACAANNQDYC* GCCSYPPCFATNSDYC* GCCSYPPCFATNSGYC* GCCSYPPCFATNPD -C* GCCSDPRCAWR C* ACCSDRRCRWR C* m/n nAChR subtype IC50 ... a 4b2 , no change for others [16] no signiﬁcant change GCCSLPVCHLEHSNLC* a 3b2 d ﬂ [53] GCCSDPRCAWE C* GCCSDPLCAWR C* GCCSNPRCAWR C* GCCSDPACAWR C* GCCSDPRCAWR C* GCCSYPPCFATNPD -C* GCCSLPPCALNNPDYC* ... The cysteine residues are highlighted in bold Conotoxin MII PnIA PnIB EpI GIC GID PIA AnIB AuIA AuIC AuIB ImI ImII a Sequence GCCSNPVCHLEHSNLC* GCCSLPPCAANNPDYC* GCCSLPPCALSNPDYC* GCCSDPRCNMNNPDYC*...

Báo cáo khoa học: Evolutionary changes to transthyretin: structure–function relationships ppt

Danh mục: Báo cáo khoa học

... 644–646 11 Bhat MK, Ashizawa K & Cheng SY (1977) Heterogeneity of chicken prealbumin and speciﬁcity in binding to chicken retinol-binding protein and L-thyroxine Indian J Biochem Biophys 14, ... structure and, as a consequence, in function of the binding afﬁnities to T3 and T4 of transthyretin Speci c residues on the external surface of transthyretin are involved in the binding to RBP ... [59,63,64] In the binding interaction, RBP and transthyretin each contribute 21 amino acids to the protein–protein recognition interface and most of these residues are in the C- terminal regions of the...

Báo cáo khoa học: Synthesis and function of ribosomal proteins – fading models and new perspectives pptx

Danh mục: Báo cáo khoa học

... regulated by mitogen-induced signal transduction pathways acting through TSC1–TSC2 and involving mTORC1, as suggested by the rapamycin effect Rapamycin, which inhibits mTORC1 by binding to mTOR in a complex ... regulation of RP mRNAs have remained more elusive In Xenopus, two proteins have been identified, La and cellular nucleic acid-binding protein (CNBP) ⁄ zinc finger protein (ZNF9), which bind the 5¢-UTRs of ... case, only in speci c cell types A role of p53 in mediating the effect of RP deficiency was also shown in a recent publication by McGowan et al [82] In a chemical mutagenesis screen in mice for pigmental...

Báo cáo khoa học: Structure ⁄function analysis of spinalin, a spine protein of Hydra nematocysts doc

Danh mục: Báo cáo khoa học

... CD spectroscopy and ﬂuorescence spectroscopy The CD spectrum of spinalin in NaCl ⁄ Tris showed a dichroic minimum centered at 205 nm (Fig 3) The spectrum did not show the presence of pronounced ... difference between the molecular masses of the reduced and nonreduced protein indi- A B C D Fig Expression of spinalin in HEK293 cells and puriﬁcation of the recombinant protein Aliquots of serum-free ... NaCl Proteins were detected by Coomassie staining (A) or samples were analyzed by western blotting using spinalin antibody (B) Visualization of nonreduced aggregated spinalin (D) and reduced and...

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Danh mục: Báo cáo khoa học

... are not coincident; however, both structures feature a hydrophobic patch in the inner region of the bent, made up by a cluster of 4/5 aliphatic and/ or aromatic side-chains These findings lend ... Wuthrich, K (1983) Application of phase sensitive ¨ two-dimensional correlated spectroscopy (COSY) for measurements of 1H-1H spin-spin coupling costants in proteins Biochem Biophys Res Comm 113, ... C For estimation of secondary structure content, CD spectra were analyzed by a linear combination fit using the reference data of Greenfield and Fasman [21] NMR spectroscopy Samples for NMR spectroscopy...

Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx

Danh mục: Báo cáo khoa học

... free aminoglycosides neomycin B, neamine and paromomycin, at concentrations Table Percent inhibition of 12G5 mAb binding to CXCR4 by R-peptide and their conjugates, and r-peptides and their conjugates, ... achieved by the reaction of benzylchloroformate (CbzCl) in the presence of sodium carbonate in high yield Then, the ‘Boc’ group was removed by a classical triﬂuoroacetic acid cleavage, affording ... step by interacting with CXCR4 Signiﬁcant differences were found between the antiviral potency of APACs containing 6- and 9-mers d-arginine, and the two aminoglycosides; neamine and neomycin In...

Báo cáo khoa học: Structure–function analysis of the ﬁlamentous actin binding domain of the neuronal scaffolding protein spinophilin pot

Danh mục: Báo cáo khoa học

... 2007 FEBS H Schuler and W Peti ¨ The actin binding domain of spinophilin A B C Fig Recombinant proteins containing N-terminal fragments of rat spinophilin are active in F-actin binding (A) Cosedimentation ... [23,25,26] Both spinophilin and neurabin contain N-terminal ﬁlamentous actin (F-actin) binding, PP1 binding, PDZ and C- terminal coiled-coil domains In addition, neurabin, but not spinophilin, contains ... compilation ª 2007 FEBS 63 The actin binding domain of spinophilin H Schuler and W Peti ¨ Fig Spinophilin F-actin binding domain constructs can crosslink and cap actin polymers Polymers of actin,...

Báo cáo khoa học: Effect of valine 106 on structure–function relation of cytosolic human thymidine kinase Kinetic properties and oligomerization pattern of nine substitution mutants of V106 ppt

Danh mục: Báo cáo khoa học

... isoleucine and threonine have one property in common, i.e branching at the b- carbon atom classically considered to destabilize a-helices because of steric clashes The side chain of leucine differs ... 5¢-CCATTTGGGGCCATCTAGAACCTGGTGC CGCTG(451–483)-3¢; antisense, 5¢-CAGCGGCACCAG GTTCTAGATGGCCCCAAATGG(483–451)-3¢ The underlined bases were changed in comparison with the original sequence; the stop codon ... template for PCR with a sense primer: 5¢- GGGGGATCCTGCA CACATGACCGGAACACC(247–273)-3¢ designed to contain a GGG overhang and an antisense primer: 5¢-CGGCACCGAATTCTAGATGGCCCCAAATGGC TTCCT(480–445)-3¢...

Báo cáo khoa học: Protein tyrosine phosphatases: structure–function relationships ppt

Danh mục: Báo cáo khoa học

... recruiting speci c ligands [4] Structural characteristics of the PTP catalytic domain The catalytic domain contains 280 amino acids that determine a speci c PTP fold with several characteristic FEBS ... disordered in the crystal structures 1YGR and 1YGU) are shown schematically in red and blue, respectively In the RPTPa D1 crystal structure (PDB accession number 1YFO) the ‘inhibitory wedge’ blocks access ... Pleiotrophin signals increased tyrosine phosphorylation of beta beta-catenin through inactivation of the intrinsic catalytic activity of the receptor-type protein tyrosine phosphatase beta ⁄ zeta Proc...

Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx

Danh mục: Báo cáo khoa học

... fluorescence of cells exposed to different concentrations of peptides, Facetic acid is the fluorescence of cells exposed to 0.01% acetic acid only, and Fbackground is the background fluorescence of ... are responsible for each of the antibacterial, LPS-binding and cytolytic activities of fowlicidin-1 (Fig 7) The C- terminal a-helix after the kink (residues 16–23), consisting of a stretch of eight ... 3271.1 instead highly concentrated at both ends To probe the impact of N- and C- terminal cationic regions and two short helical segments on antibacterial, LPS-binding, and cytolytic activities of...

Báo cáo y học: "What does the structure-function relationship of the HIV-1 Tat protein teach us about developing an AIDS vaccine?" ppsx

Danh mục: Báo cáo khoa học

... histocompatibility complex (MHC) class I and II, lymphotoxin, chemokine (C- C motif) ligand (CCL) 3, CCL4, CCL5, interleukin (IL)-12 and tumor necrosis factor (TNF) [51] Interaction of Tat with integrins ... Beclin-1 possesses a BH3 domain that interacts with the BH3 receptor domain of the anti-apoptotic proteins of the Bcl-2 family BH3-only proteins can induce autophagy by competitively disrupting ... then induce mitochondrial membrane permeabilization resulting in the release of critical pro-apoptotic intermembrane space effectors into the cytosol such as cytochrome c, apoptosis-inducing factor,...

STRUCTURE-FUNCTION ANALYSIS OF CXXC FINGER PROTEIN 1

Danh mục: Y khoa - Dược

... ANALYSIS OF CXXC FINGER PROTEIN This dissertation describes structure- function studies of CXXC finger protein (Cfp1), encoded by the CXXC1 gene, in order to determine the functional significance of Cfp1 ... at CpG dinucleotides These chromatin modifications in combination with polycomb group proteins all contribute to and ensure the maintenance of X inactivation by maintaining a heterochromatic configuration ... transcription factors, including Ap-2, c- Myc/Myn, Creb, E2F, and NF- B, recognize sequences that contain CpG dinucleotides, and binding to each has been shown to be inhibited by methylation (Singal...

Comparatives study on sequence structure function relationship of human short chain dehydrogenases reductases

Danh mục: Tổng hợp

... (UCU, UCC, UCA, UCG, AGU and AGC) and Alanine is encoded with four codons (GCU, GCC, GCA and GCG) Hence, the simple way for changing Serine into Alanine is by a single transition of amino acid, ... row contains the characters of V and the second the characters of W Matching characters, in V and W, are placed in the same column and different characters are placed as a mismatch in the same column ... location of the active and binding sites of the protein This is because active and binding sites are responsible for any chemical and or enzymatic reactions that happened in the protein molecules...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25

structure function relationships of hydrophobic proteins sp b and sp c in pulmonary surfactant