statistical blockade estimating rare event statistics for memories by amith singhee and rob a rutenbar
algebraic statistics for computational biology - lior pachter and bernd sturmfels
Ngày tải lên :
08/04/2014, 13:10
... computational biology or mathematical statistics: ours are written in the language of abstract algebra The algebraic language for statistics clarifies many of the ideas central to the analysis ... ℓ(θ) Example 1.16 Our data are two DNA sequences of length 40: ATCACCAAACATTGGGATGCCTGTGCATTTGCAAGCGGCT ATGAGTCTTAAACGCTGGCCATGTGCCATCTTAGACAGCG (1.41) We wish to test the hypothesis that these ... example of a toric model in statistics is the independence model for two random variables Let X1 be a random variable on [m1 ] and X2 a random variable on [m2 ] The two random variables are independent...
- 432
- 267
- 0
For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx
Ngày tải lên :
14/03/2014, 18:20
... Lisa: To Sarah and Hannah—beautiful daughters and delightful friends, and Brandon a great young man in training From Shaunti: To a wonderful young lady and little laddie, who in a few short years ... tons of research and data gathering about men that no one had done before Turns out, her Harvard graduate degree and years as a Wall Street analyst helped pave the way for these well-researched books! ... that the answer is yes and that this one fact creates a bunch of ideas for you to think about, as a girl and down the road, as a woman RESPECT VERSUS LOVE Just after college, I (Shaunti) watched...
- 35
- 320
- 0
landslide hazard and risk assessment for road network using rs and gis a case study of xin man district, vietnam
Ngày tải lên :
03/10/2014, 13:14
... map Landslides map Lineament map Landslides map Elevation map Landslides map Slope map Landslides map Drainage map Landslides map Distance map Landslides map Criteria definition Landslide hazard ... landslide hazard model This model was compared to existing landslide data, and to the current terrain stability mapping standard to assess model accuracy -Amod Sagar, Takaaki Amoda and Masamu Aniya (1997) ... factor maps On the basis of these CF value all factor maps are recoded and matrix analysis was perform to produce a Landslide Hazard Zonation map The Landslide Hazard Zonation map has been applied...
- 142
- 465
- 1
Excel for auditors by bill jelen and dwayne k dowell
Ngày tải lên :
01/04/2017, 08:46
... Figure 40 Calculating forecasted sales by copying the same formula to a range of cells using a relative reference and a fixed multiplicand Fixed Value in Formula You probably take it for granted, ... display as a percentage) and have the formula in cell C4 point to =D1*1.05 This formula calculates the same result Figure 41 Calculating forecasted sales in a single cell using a formula with ... Replacing a Thousand Formulas with One Replacing a Thousand Formulas with One Here’s the Situation You have data that has 5000 records with quantity and unit price You would like to calculate...
- 226
- 568
- 0
Running a bar for dummies by ray foley and heather dismore
Ngày tải lên :
26/03/2018, 16:26
... and foremost, I want to thank Heather Dismore for her outstanding writing ability and patience with me You’re the best! Tracy Boggier, Natalie Harris, and Vicki Adang for all their help and assistance; ... vigilance, and the ability to control potentially chaotic situations — on a daily basis Chapter 2: Understanding What It Takes to Own and Operate a Bar Take out a pen and some paper Divide the paper ... Solomon and his 50 years’ experience; Dr Lawrence Nastro, Rita Mazzarisi, Martin Margolis, attorney-at-law, James Zazzali, George Delgado, Dave Conway, Rene Bardel at Tu Tu Tango, Hymie Lipshitz, and, ...
- 362
- 112
- 0
Six sigma workbook for dummies by craig gygi and bruce williams
Ngày tải lên :
06/04/2018, 15:18
... Individuals and Moving Range (I-MR) Chart 249 Raising the Bar for Small Samples: Averages and Ranges ( X-R) Charts .252 Making a p Chart for Your Attribute Data 256 Creating a u Chart for ... findings From that time, Craig has applied, taught, and led Six Sigma in all his endeavors, including management and technical capacities at Motorola, Iomega, and General Atomics In 1998, Craig founded ... is that a well-proven and time-tested prescriptive formula for your deployment is available In this chapter, you apply this formula to your organization and situation, and as a result, you and...
- 314
- 474
- 0
Developing ebay business tools for dummies by john kaufeld and tim harvey
Ngày tải lên :
28/04/2018, 08:28
... that will change your eBay business forever, you can probably make it happen with the help of a standard programming language and the eBay API This part not only introduces and explores the eBay ... Specialist: Kit Malone Media Development Manager: Laura VanWinkle Project Coordinator: Nancee Reeves Layout and Graphics: Andrea Dahl, Lauren Goddard, Joyce Haughey, Stephanie D Jumper, Barry ... overview of what various technologies can for your eBay appearance, planning, followup, and sales From there, it lays a foundation for evaluating, selecting, and adding all kinds of technological wonders...
- 386
- 991
- 0
An Equilibrium Model of Rare-Event Premia and Its Implication for Option Smirks potx
Ngày tải lên :
07/03/2014, 10:20
... and Wang (1994), Anderson, Hansen, and Sargent (2000), Chen and Epstein (2002), Hansen and Sargent (2001), Epstein and Miao (2003), Routledge and Zin (2002), Maenhout (2001), and Uppal and Wang ... established by Maenhout (2001) and Skiadas (2003), since we add a new dimension to the problem: rare events and uncertainty aversion only toward rare events 4.3.2 The case of habit formation An ... knowledge about rare events We modeled rare events by adding a jump component in aggregate endowment and modified the standard pure-exchange economy by allowing the representative agent to perform robust...
- 34
- 500
- 0
Báo cáo sinh học: " Local sequence alignments statistics: deviations from Gumbel statistics in the rare-event tail" pps
Ngày tải lên :
12/08/2014, 17:20
... [9,10] was found For alignments with gaps, such analytical expressions are not available Approximation for scenarios with gaps based on probabilistic alignment [11-13], large deviations [14] and a ... alignments formally and state a few main results on the statistics of local sequence alignment Next, we state the rare- event approach used here and in the fourth section we explain our approach ... sequences Arratia and Waterman [24] predicted a phase transition between a linear phase and a logarithmic phase, i.e a linear growth of the excepted score as a function of the sequence length, changing...
- 17
- 329
- 0
Economic Statistics for NOAA
Ngày tải lên :
17/12/2013, 08:40
... Secretary of Commerce for Oceans and Atmosphere Administrator, National Oceanic and Atmospheric Administration Washington, DC April 2005 Economic and Social Impacts Weather and Climate Impacts Weather ... Southeast Florida Hazen and Sawyer, Final report for Broward, Palm Beach, Miami-Dade and Monroe Counties, Florida Fish and Wildlife Conservation Commission and National Oceanic and Atmospheric Administration ... Oceanic and Atmospheric Administration, Coastal Ocean Program under awards NA87OA0381, NA96OP0187, NA06 0A0 388, and NA 16 0A1 449 to the University of Hawaii Coral Reef Initiative Research Program...
- 56
- 262
- 1
Tài liệu Statistics for Environmental Engineers P2 doc
Ngày tải lên :
20/01/2014, 01:20
... 3.3 Waste Load Survey Data Analysis The table gives 52 weekly average flow and BOD5 data for wastewater Plot the data in variety of ways that might interest an engineer who needs to base a treatment ... facilitate understanding the data It is loaded with what Tufte (1983) calls chartjunk— three-dimensional boxes and shading “Every bit of ink on a graphic requires a reason And nearly always that reason ... the average peak value at each concentration level which has flattened the data by looking at deviations from the average of the three values at each level An important fact is revealed: the measurement...
- 10
- 402
- 1
Tài liệu Statistics for Environmental Engineers P1 ppt
Ngày tải lên :
20/01/2014, 01:20
... calculated from the sample Statistics are random variables and are characterized by a probability distribution that has a mean and a variance All measurements are subject to experimental (measurement) ... Sampling Distribution of the Average and the Variance All calculated statistics are random variables and, as such, are characterized by a probability distribution having an expected value (mean) ... were made The data thus have a special relevance and reality that should make it easier to understand special features of the data and the potential problems associated with the data analysis...
- 40
- 453
- 1
Tài liệu Create New Event Monitor For Locking ppt
Ngày tải lên :
21/01/2014, 23:20
... areas • • • • • • • • TOTAL TRANSACTIONS BUFFER POOL HIT RATIOS (DATA, INDEX, TEMP) READS AND READ EFFICIENCIES SORTING LOCKS PAGE CLEANING PACKAGE CACHE CAPACITY TRANSACTION LOGS • Save data ... temporary data • With BP_HITRATIO administrative view Example: Returns bufferpool hit ratios, including total hit ratio, data hit ratio, XDA hit ratio and index hit ratio, for all bufferpools and all ... ratios • With MON_BP_UTILIZATION monitor view Hit Ratio for All Data,Index, and XDA for each Bufferpool SELECT SUBSTR(bp_name ,1,30) as BPNAME, data_hit_ratio_percent as DATA_HR, index_hit_ratio_percent...
- 14
- 304
- 0
Tài liệu Creating an Event Monitor for Statements doc
Ngày tải lên :
21/01/2014, 23:20
... Enhanced reporting and monitoring of the database system, data objects, and the package cache Lightweight - has a lower impact on the system than existing system monitor and snapshot interfaces ... ¾ Changes in the data model ¾ Changes in the data ắ Changes in configuration parameters View statistics used at time of optimization and current performance VISUAL EXPLAIN How to use Visual Explain ... using SQL ¾ Access Plan Graph • For dynamic and static SQL statements Visual Explain Interface • Every object in the visual explain interface can be drilled down for additional information • Cost...
- 15
- 348
- 0
Tài liệu Response statistics for ''''New Legislative Framework for the marketing of products: proposal to align 10 product harmonisation directives to Decision 768/2008.'''' pdf
Ngày tải lên :
19/02/2014, 03:20
... Moderate increase in operating costs and/ or adm burden Significant increase in operating costs and/ or adm burden N /A C27 If you answered that Action may result in a significant increase in operating ... streamlined The new procedure ensures that the relevant enforcement authorities are informed about dangerous products and that equivalent action is taken against that product in all Member States ... the obligations that the current legislation already foresees for manufacturers they must provide instructions and safety information in the language easily understood by consumers and end-users...
- 18
- 425
- 0
Performance Modeling of Critical Event Management for Ubiquitous Computing Applications pptx
Ngày tải lên :
07/03/2014, 17:20
... to state , is the average probability of criticality at state , is the average probability of reaching if no additional criticality occurs at state , and is the average probability of reaching ... Further, it had a limited scope to manageability as it only addressed situations with single criticality Here, we take a more comprehensive and formal approach and rigorously analyze the manageability ... critical events Any system in a critical state, therefore, 1) has to detect and evaluate the severity of the critical events, 2) plan and schedule appropriate mitigative actions according to the available...
- 8
- 534
- 0
Summary Health Statistics for U.S. Children: National Health Interview Survey, 2010 pdf
Ngày tải lên :
14/03/2014, 09:20
... Better than last year About the same as last year Fair or poor Worse than last year Better than last year About the same as last year Worse than last year Number in thousands2 Large MSA ... than last year Selected characteristic About the same as last year Good Worse than last year Better than last year About the same as last year Fair or poor Worse than last year Better than last ... Current health status † Estimates with a relative standard error greater than 50% are indicated with a dagger, but data are not shown * Estimates preceded by an asterisk have a relative standard error...
- 89
- 738
- 1
Statistics for Nursing and Allied Health pot
Ngày tải lên :
15/03/2014, 09:20
... Statistics for Nursing and Allied Health Stem -and- Leaf Displays Stem -and- leaf displays, also known as a stemplots, are alternative ways of graphing data (Cleveland, 1988) They are similar to histograms ... statistics: descriptive and inferential Descriptive statistics are simply numerical or graphical summaries of data, including charts, graphs, and simple summary statistics such as means and standard ... influenza vaccine, and any apparent differences are attributable to chance (see Chapter 10 for more information about chi-square analysis) Prediction and Control Studies and Inferential Statistics...
- 434
- 4.3K
- 0
Genetic Genealogical Models in Rare Event Analy- sis pdf
Ngày tải lên :
16/03/2014, 19:20
... called restart Vill´n-Altamirano and Vill´n-Altamirano e e (1991); Tuffin and Trivedi (2000) can also be used to compute rare transient events and the probability of rare events in steady state, not ... D Aldous Probability approximations via the Poisson clumping heuristic Applied Mathematical Sciences 77 (1989) A N Borodin and P Salminen Handbook of Brownian motion — facts and formulae In Probability ... Vill´n-Altamirano and J Vill´n-Altamirano RESTART: A method for accelere e ating rare event simulations In 13th Int Teletraffic Congress, ITC 13 (Queueing, Performance and Control in ATM), pages 71–76...
- 23
- 263
- 0
A Comparison of Event Models for Naive Bayes Text Classi cation potx
Ngày tải lên :
16/03/2014, 19:20
... the task of text classification in a Bayesian learning framework This approach assumes that the text data was generated by a parametric model, and uses training data to calculate Bayes-optimal estimates ... 35th Annual Meeting of the Association for Computational Linguistics, 1997 Ray Liere and Prasad Tadepalli Active learning with committees for text categorization In AAAI-97, 1997 Andrew McCallum, ... Journal of the American Society for Information Science, 27:129–146, 1976 Mehran Sahami, Susan Dumais, David Heckerman, and Eric Horvitz A bayesian approach to filtering junk e-mail In AAAI-98...
- 8
- 519
- 0