states play a central role in maximizing the impact ofepsdt comprehensive well child screening visits

Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

Ngày tải lên : 12/08/2014, 11:23
... Nakano K, Okada Y, Saito K, Tanikawa R, Sawamukai N, Sasaguri Y, Kohro T, Wada Y, Kodama T, Tanaka Y: Rheumatoid synovial endothelial cells produce macrophage colony-stimulating factor leading ... aberrantly activated: an increase in macrophage infiltration Page of 15 of the synovium promotes inflammation via the production of TNF and other proinflammatory cytokines, and an increase in osteoclast ... clinical improvement in three refractory cases Ann Med 2003, 35:362-367 10 Koyama K, Hatsushika K, Ando T, Sakuma M, Wako M, Kato R, Haro H, Sugiyama H, Hamada Y, Ogawa H, Nakao A: Imatinib mesylate...
  • 15
  • 411
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Ngày tải lên : 07/03/2014, 16:20
... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... and resuspended in M9-medium containing a cysteine- and methionine-free amino acid mix After recovery for 15 (pBAD18-SufIHA harboring strains) or 90 (pJH42 harboring strains) at the appropriate...
  • 9
  • 393
  • 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Ngày tải lên : 09/08/2014, 08:22
... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was weak-moderate ... received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated by the arrow, although the staining was not considered...
  • 8
  • 335
  • 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Ngày tải lên : 23/03/2014, 15:20
... the charge attraction between DNA phosphates and the amino groups of polyamines As the amino groups of polyamines are already engaged in ionic bonds with the phosphates of NAPs, secondary amino ... forces play a greater role in the A Z transition than they in the B–Z transition, because the difference in the linear charges density is greater between the A and the Z forms than between the B and ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging,...
  • 11
  • 380
  • 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Ngày tải lên : 31/03/2014, 15:20
... this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter ... state the partner a chains may take, the oxy-form or the ferric met-form Unlike separated b chains, the spontaneous formation of hemichrome was at variance with separated a chains in the pH range ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against the...
  • 10
  • 648
  • 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Ngày tải lên : 18/06/2014, 16:20
... acetylsalicylic acid (ASA) was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was ... wall shear rate of 500s-1 Then hirudin-anticoagulated blood containing mepacrine (10 μM) in order to visualize platelets was added to the inlet well, and chambers were perfused for 10 at a wall ... By using NSC23766, our group recently unraveled a Ca2+ -dependent pathway regulating secretion in thrombin-stimulated human platelets linking Rac1 activation to actin dynamics: Calcineurin®Rac1...
  • 10
  • 441
  • 0
Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc

Ngày tải lên : 20/06/2014, 01:20
... aligned using Clustal X [12] To gain an initial insight into possible recombination events, each of the eight data sets was analyzed respectively using the 3SEQ [13], the Chimaera [14], and the ... derived by plaque purification Furthermore, the same laboratory was the source for all four recombinants and the one putative parental strain As suggested in influenza A virus [9], further work ... shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from...
  • 3
  • 282
  • 0
Báo cáo y học: " Media and education play a tremendous role in mounting AIDS awareness among married couples in Bangladesh" potx

Báo cáo y học: " Media and education play a tremendous role in mounting AIDS awareness among married couples in Bangladesh" potx

Ngày tải lên : 10/08/2014, 05:20
... interpersonal communication The role of international health and development organizations in promoting, supporting and advocating the use of well- planned mass media campaigns can also make a ... study has aimed to examine the association between AIDS awareness and a set of independent variables The set of independent variables are women educational attainment, current engagement in an income ... monitoring and evaluation regarding AIDS awareness In this regards a few national and international researchers have made attempts to understand the reasons and come up with some explanations...
  • 7
  • 381
  • 0
Recent global economic slowdown requires a new growth model for asia, where small and medium enterprises play a greater role in boosting national productivity

Recent global economic slowdown requires a new growth model for asia, where small and medium enterprises play a greater role in boosting national productivity

Ngày tải lên : 08/09/2015, 23:32
... in East Asia; (iii) Bangladesh, India, and Sri Lanka in South Asia; (iv) Cambodia, Indonesia, Malaysia, the Philippines, Thailand, and Viet Nam in Southeast Asia; and (v) Papua New Guinea and ... Southeast Asia and two countries from each of Central Asia, East Asia, South Asia, and the Pacific) Bangladesh and Myanmar, only data on manufacturing are available; with Myanmar only providing ... 1.2: Data Compilation Flow South Asia Central and West Asia BAN, IND, and SRI KAZ, KYR,* and TAJ* Southeast Asia East Asia Pacific Asia CAM, INO, LAO*, MAL, MYA*, PHI, THA, and VIE PRC, KOR, and...
  • 317
  • 446
  • 0
The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

The Carbon and Global Warming Potential Impacts of Organic Farming: Does It Have a Significant Role in an Energy Constrained World? pptx

Ngày tải lên : 08/03/2014, 23:20
... conducted a review of the sustainability of organic grain production on the Canadian Prairies, including many of the Canadian studies discussed in detail below Notably, the authors conclude that management ... Dairying in Maritime Canada; M.Sc Thesis; NSAC and Dalhousie University: Halifax, NS, Canada, 2001 57 Main, M.H.; Lynch, D.; Martin, R.C.; Fredeen, A Sustainability profiles of Canadian dairy farms ... Sustainability 2011, 332 Peters et al [52] in Australia using an LCA analyses considered three scenarios; (1) a sheep meat supply chain in Western Australia, (2) a beef supply chain in Victoria, Australia...
  • 41
  • 524
  • 1
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Ngày tải lên : 16/03/2014, 04:20
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The...
  • 13
  • 385
  • 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Ngày tải lên : 16/03/2014, 16:20
... structural data for the PA–substrate interactions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral intermediate in PA presents some indications ... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... protein chain, acting as a flap, first opening and then closing the groove [45] The catalytic reaction presumably occurs when the ionized carboxyl group of PG approaches the guanidine side chain...
  • 8
  • 438
  • 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Ngày tải lên : 31/03/2014, 01:20
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... LPCAT activity significantly inhibits LPS-induced TNF -a and IL-6 production, strongly suggesting that LPCAT plays an important role in mediating the signaling pathways for LPS-activation of these ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical...
  • 7
  • 322
  • 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Ngày tải lên : 18/06/2014, 18:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx ... similar to the processing of the other VV core proteins in that the cleavage is sensitive to rifampicin, takes place at the conserved recognition motif, Ala-Gly-Ala (AG /A) , and is associated...
  • 6
  • 397
  • 0
Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Báo cáo hóa học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition" pdf

Ngày tải lên : 20/06/2014, 01:20
... and pA12L-reverse: 5'-CAGGATCCTTAATACATTCCCATATCCA GACAAC; p233-forward: 5'ATGGCGGATAAAAAAAATTTAGCC and A1 2L-reverse: 5'TTA ATACATTCCCATATCCAGACAAAATTCG In order to construct A1 2L with abrogated ... 55–57 (underlined), 5'CTTAATTCTCAAACAGATGTGACTATCGACATCTGTGATACAAAATCAAAGAGTTCA-3' The AG /A site-mutated A1 2L was inserted in pRB21 vector References For transfection of the plasmids into T-REx ... similar to the processing of the other VV core proteins in that the cleavage is sensitive to rifampicin, takes place at the conserved recognition motif, Ala-Gly-Ala (AG /A) , and is associated...
  • 6
  • 401
  • 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Ngày tải lên : 09/08/2014, 10:20
... TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA 3' 5' GCC GGG ACA CAC GGA GTA 3' 99.74% ADAMTS ... the aging and degenerating intervertebral disc: immunolocalization of senescence-associated beta-galactosidase in human and sand rat discs Spine 2007, 32:321-327 Martin JA, Buckwalter JA: Aging, ... 99.65% P16INK 4a 5' GGC TCT ACA CAA GCT TCC TTT CC 3' 5' FAM – CCC CCA CCC TGG CTC TGA CCA – TAMRA 5' TCA TGA CCT GCC AGA GAG AAC A 3' 99.22% MMP-13 5' CCC CAG GCA TCA CCA TTC AAG 3' 5' FAM – AGG GGT...
  • 12
  • 617
  • 0
báo cáo khoa học: " Determinants of the intention of elementary school nurses to adopt a redefined role in health promotion at school" docx

báo cáo khoa học: " Determinants of the intention of elementary school nurses to adopt a redefined role in health promotion at school" docx

Ngày tải lên : 10/08/2014, 10:23
... the instrument involves qualitative and quantitative approaches The qualitative part consisted of obtaining information relevant to the study behaviour (i.e., adopting the new nursing role) according ... participants to determine their intention regarding the hypothetic role, since none of them has played this precise role in the past There is also a potential influence of the social desirability bias ... Group on Behaviour and Health, Faculty of Nursing, Laval University, Québec, Canada 2Canada Research Chair on Behaviour and Health, Laval University, Québec, Canada 3Faculty of Nursing, Laval University,...
  • 10
  • 458
  • 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

Ngày tải lên : 11/08/2014, 11:21
... altered sulphate compartmentalization BMC Plant Biol 2010, 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate ... of Arabidopsis mutants for the group sulfate transporters indicates a role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi ... Takahashi H, Watanabe-Takahashi A, Smith FW, Blake-Kalff M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis...
  • 10
  • 427
  • 0
Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Báo cáo y học: "The membrane-spanning domain of gp41 plays a critical role in intracellular trafficking of the HIV envelope protein" pptx

Ngày tải lên : 13/08/2014, 01:20
... GGCTTGGTAGGTTTAGCTAGAATAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCTTAAGGCAGCACCTACCAAGCCTC,695+ 3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, ... GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+ 2A, GAGGCTTGGTAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT GCTG/CAGCAAAAACTATTCTGGCAGCTAAGGCAG CACCTACCAAGCCTC The NheI-BamHI fragment ... GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAGTTTTTGCTGTACGTACAGCAAAAACTATTCTTAATGCGGCCGCACCTACCAAGCCTCCTAC, 695+ 4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAAGAATAGTTT TTGCTGTAC/GTACAGCAAAAACTATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+ 2A, GCTTGGTAGGTTTAGCTGCCAGAATAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG...
  • 12
  • 337
  • 0
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Ngày tải lên : 14/08/2014, 08:20
... demonstrate an increased translation of these transcripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... transport Proc Natl Acad Sci USA 2001, 98:5306-5311 Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi ... Hamakubo T, Naito M, Auwerx J, Yanagisawa M, Kodama T, Sakai J: Activation of peroxisome proliferator-activated receptor delta induces fatty acid betaoxidation in skeletal muscle and attenuates...
  • 14
  • 384
  • 0

Xem thêm