split of the barrel under a typical tax and royalty system
MAKING DECISION IN OIL FILED
Ngày tải lên :
24/09/2016, 22:06
... each payoff by the probability of that state of nature and adding the amounts Thus, the best payoff under low demand is $10, the best payoff under moderate demand is $12, and the best payoff under ... allowances may be made against the tax rate These are called fiscal costs and opex and capital allowances (which is Fiscal costs may also be referred to as fiscal costs = royalty + opex + capital ... Split of the barrel under a typical tax and royalty system 3.1.6 Inflation Inflation increases the price of goods and erodes the purchasing power of money over time When making estimates of the...
- 62
- 557
- 0
Báo cáo khoa học: "Solitary fibrous tumor of the male breast: a case report and review of the literature" pptx
Ngày tải lên :
09/08/2014, 07:21
... in table The interest of the present case relies on its rarity and in the difficulties to achieve the exact diagnosis, because this tumor has no typical radiological features and cytological aspects ... uncommon and account for less than 0.2% of all primary breast lesions, without a striking difference of incidence between male and female as for ductal epithelial cancers [1] The majority of cases ... that chemotherapy and radiation are effective The local recurrence or onset of metastases mainly depends on histological parameters Although most solitary fibrous tumours are characterized by a...
- 4
- 359
- 0
Báo cáo y học: "Primary leiomyosarcoma of the right atrium: a case report and literature updat" ppsx
Ngày tải lên :
10/08/2014, 09:22
... neoplasms with Leiomyosarcomas to consist of 8% of cardiac sarcomas [6,7] As per Kim et al [8] angiosarcomas and unclassified sarcomas are the most common sarcomas of the heart accounting for 76 %of ... are rare and will always pose a diagnostic dilemma Nevertheless, atypical presentation of suspected “atrial myxoma” should raise the possibility of rare atrial tumors Unfortunately, almost half ... conceived of the study and wrote the manuscript with the help of MTA VY overlooked the progress of the manuscript and advised on valuable points All authors read and approved the final manuscript...
- 4
- 422
- 0
Báo cáo y học: "Papillary fibroelastoma of the aortic valve - a case report and literature review" pptx
Ngày tải lên :
10/08/2014, 09:22
... Vardas P: Asymptomatic papillary fibroelastoma of the aortic valve in a young woman -a case report Cardiovascular Ultrasound 2009, 7:43 Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report ... fibroelstoma of the heart: report of two cases and review of the literature Annals of Clinical & Laboratory Science 2001, 31(3):291-296 Parthenakis F, Nyktari E, Patrianakos A, Pitsis A, Asimaki A, Vardas ... patient was taken for urgent surgical resection under standard cardiopulmonary bypass at systemic hypothermia (32 degree Celsius) and systemic heparinisation The ascending aortic and right atrial...
- 5
- 631
- 0
báo cáo khoa học: "Angiofibroma of the spermatic cord: a case report and a review of the literature" potx
Ngày tải lên :
10/08/2014, 23:20
... differential diagnosis can be narrowed down to AAM, AMF, and SFT as follows: (1) AAM has a highly infiltrative pattern Conclusion Cellular AF is a benign neoplasm of the scrotal and inguinal area, is ... expression of CD34 (vascular origin), 21% have spinal muscular atrophy (epithelial and/ or glandular origin), and 8% reveal desmin (muscular origin) [3] In our patient, the mass was an AF of vascular ... fibroblasts, and of vascular origin A safe initial diagnosis is difficult because of its location, nature, and correlation with other structures of the area It can easily be confused with a hernia,...
- 4
- 385
- 0
báo cáo khoa học: "Bronchogenic cyst of the ileal mesentery: a case report and a review of literature" docx
Ngày tải lên :
11/08/2014, 02:21
... ligation small and are usually discovered incidentally because patients are asymptomatic, though sometimes there can be epigastric or left upper quadrant abdominal pain Malignant transformation ... the data from our patient; CB and EE were major contributors to the writing of the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they ... subdiaphragmatic masses, even in intraperitoneal location Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the...
- 5
- 364
- 0
Báo cáo y học: " Bullet-induced synovitis as a cause of secondary osteoarthritis of the hip joint: A case report and review of literature" ppt
Ngày tải lên :
11/08/2014, 10:23
... effects of intra-articular lead implants on the synovium, articular cartilage and meniscus of white rabbits at 4, 6, 10 and 14 weeks Articular and meniscal changes that Harding et al came across were ... review and formatting the material All authors read and approved the final manuscript Consent The authors confirm that a formal written consent was taken for the publication of this case report ... mechanical destruction of joint may be caused by several factors Firstly the initial trauma may cause fractures of articular bone, leading to an incongruous and irregular joint surface Motion of...
- 4
- 343
- 0
Báo cáo y học: "Cetuximab in the treatment of metastatic mucoepidermoid carcinoma of the salivary glands: A case report and review of literature" doc
Ngày tải lên :
11/08/2014, 21:22
... resection of a high-grade MEC of the right submandibular salivary gland at another institution Postoperative radiotherapy was not advised, and three months later, the disease progressed locally and ... advanced salivary gland cancers J Clin Oncol 2006, 24:2673-2678 Agulnik M, Siu LL: An update on the systemic therapy of malignant salivary gland cancers: role of chemotherapy and molecular targeted ... the salivary glands J Clin Oncol 2007, 25:3978-3984 The authors wish to thank Dr Paola Casieri for EGFR immunohistochemical and FISH analyses and Prof Alessandro Padovani and Prof Stefano M Magrini...
- 5
- 335
- 0
Báo cáo y học: "Necrotizing Fasciitis of the lower extremity: a case report and current concept of diagnosis and management" ppsx
Ngày tải lên :
13/08/2014, 23:20
... GN and SM have been involved in drafting of this manuscript and WJ has revised and corrected the manuscript and given final approval for the publication All authors read and approved the final ... CT scan1 right in vastus latralisinflammatory stranding and Figure of CT scan of right thigh, showing inflammatory stranding and low attenuation in vastus latralis (arrow) lace technique IV antibiotics ... cells and prevents adequate delivery of antibiotics Hence, surgical debridement is the mainstay therapy for NSTI, and antibiotic therapy alone is of little value and only mask the severity of the...
- 7
- 542
- 1
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
Ngày tải lên :
31/03/2014, 08:20
... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... and Y82TAA are at subsite )1 as are H92AMY2 and H122TAA; M52AMY2 (M53AMY1) and W83TAA are at subsite )2; T94AMY2 (C95AMY1) at subsite-5 [38,45]; and Y104AMY2 at subsite-6 (B) Stereo view of the ... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and...
- 14
- 557
- 0
báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx
Ngày tải lên :
11/08/2014, 02:21
... performed the biopsy and surgery, FTK and EGB analyzed and interpreted the clinical data, and FTK was a major contributor in writing the manuscript All authors read and approved the final version of the ... necrosis and vascular invasion are found in atypical carcinoid tumor The prognosis of atypical carcinoid tumor is poorer than that of typical carcinoid tumor, with a 5-year survival rate of approximately ... to the supraglottic area and there was no lymphatic metastasis Atypical carcinoid tumors of the larynx are more common and more aggressive than other neuroendocrine tumors of the larynx [1] The...
- 4
- 224
- 0
Sanitation in Urban Poor Settlement and the Importance of Education for the Reduction of the Diffused Pollution - A Case Study of Bauniabad, Bangladesh
Ngày tải lên :
05/09/2013, 09:08
... of Advanced Studies (UNU-IAS) and Environment and Research Population Center (EPRC) We thank people living in Bauniabad, staffs of Dhaka Water and Sewerage Authority, staffs of EPRC and all the ... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... they agreed to bear 100% of the cost of the cleaning of the connection system such as pipes and connection pits in the case of blockage At this stage, the regular maintenance and cleaning of the...
- 9
- 971
- 0
A contrastive study of connotation of the vietnamese zodiac animals in english and vietnamese idioms and proverbs
Ngày tải lên :
26/11/2013, 13:29
... charts As a result, connotations of VZAs in English and other authors and evidence from the data analysis Vietnamese idioms and proverbs have been described clearly, carefully and systematically ... is may be beneficial to learners and In most idioms and proverbs of the two languages, VZAs are used in teachers of both languages The contrastive analysis will offer them a metaphorical and ... compares the VZA images and their connotations A between the two languages Horse and pig are more popular in contrastive analysis has been done with both qualitative and English but other VZAs...
- 13
- 1.1K
- 4
A contrastive analysis of semantic and pragmatic features of the words denoting birds in english and vietnamese
Ngày tải lên :
26/11/2013, 13:30
... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic ... fields as well as pragmatic features of the WDBs The finding of the pragmatic features of the WDBs leads both teachers and learners of study may be in one way or another beneficial to the language ... the fact that - Syntactic and cultural features of the WDBs learners generally impose the use of their culture on that of the target - Semantic and pragmatic features of the idioms language is very...
- 13
- 1.7K
- 5
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
Ngày tải lên :
20/12/2013, 23:15
... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written ... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant ... registration are unrelated to those listed in the application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the...
- 8
- 416
- 0
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
Ngày tải lên :
18/02/2014, 16:20
... cytokinesis, and growth at elevated temperature, on the one hand, and in cortical actin-patch polarization, on the other hand, are at least partially distinct [23] However, there may still be a functional ... YCplac111 pAS2-1 pACT2 pAM236 pAM237 pAM241 pAM252 pAM253 pAM872 pAM873 pAM874 pAM875 pAM876 pAM877 pAM878 pAM879 pAM880 pAM881 pAM882 pAM883 pAM884 pAM885 pAM886 pAM887 pAM888 pAM889 pAM890 pAM891 ... polyclonal GFP-specific antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase...
- 23
- 679
- 0
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
Ngày tải lên :
19/02/2014, 05:20
... Expression and purication of human recombinant IF and TC The recombinant Cbl binding proteins and their fragments were isolated from plants and yeast as described earlier [9,17] Preparation of the unsaturated ... observation points to a reduced number of potential proteinligand bonds when the two domains are taken apart On the other hand, simultaneous interaction of the two fragments domains with the sandwiched ... calculation of k+ We have tested the application of the uorescent analogue CBC as a tool for investigation of the binding kinetics of nonuorescent ligands Cyano-cobalamin (CNCbl) was examined in the...
- 12
- 603
- 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx
Ngày tải lên :
19/02/2014, 12:20
... GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or T; R ¼ A or G; Y ¼ C or T transcription The cDNA was ... the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative ... terminal transferase A (Biolabs) Two amplification steps were performed using AS3R/oligo-dT and AS4/oligo-dT at the annealing temperature of 57 °C and 58 °C, respectively The 5¢ RACE fragment was...
- 6
- 737
- 0
Research Program of the Partnership for a New Generation of Vehicles doc
Ngày tải lên :
06/03/2014, 15:20
... OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering ... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory,...
- 134
- 466
- 0