soc approach to optimal liabilities of a large insurer
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
Ngày tải lên :
20/06/2014, 22:20
... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately ... stability of Jensen’s functional equation J Inequal Pure Appl Math (2003) Article doi:10.1186/1029-242X-2011-82 Cite this article as: Bae and Park: A fixed-point approach to the stability of a ... T-S: A fixed point approach to the stability of the cubic functional equation Bol Soc Mat Mexicana 12(1), 51–57 (2006) (3) Jung, S-M, Kim, T-S, Lee, K-S: A fixed point approach to the stability of...
- 7
- 429
- 0
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf
Ngày tải lên :
21/06/2014, 11:20
... (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) ... 3B50 3A3 1 3B51 3B54 3B35 3B38 3A2 6 3A2 7 Controller 3A2 2 3A2 3 3A2 1 3A1 8 3A1 4 3A1 1 3A1 9 3A2 0 3A7 3A4 3A1 3A1 0 3A1 5 3A8 3A1 6 3A9 3A2 3A6 3A3 Figure 13: Spatial distribution of the individual success ... evaluated a retail application but it is possible and desirable to evaluate other application domains like agricultural machinery, building or home automation, structural health monitoring, and...
- 12
- 523
- 1
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
Ngày tải lên :
22/06/2014, 11:20
... approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton ... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor,...
- 7
- 257
- 0
Báo cáo hóa học: " Research Article A Fixed Point Approach to the Stability of a Volterra Integral Equation" pptx
Ngày tải lên :
22/06/2014, 19:20
... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 [10] Th M Rassias, “On the stability of functional equations and a problem of ... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability and the Hyers-Ulam stability of the Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 [6] D H Hyers, G Isac, and Th M Rassias, Stability of Functional Equations...
- 9
- 278
- 0
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt
Ngày tải lên :
12/08/2014, 14:20
... meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, ... Patients' contribution Sixty patients with ARA were enrolled at a hospital-based allergy outpatient clinic Patients older than 18 years of age, with a medical diagnosis of ARA, able to read and ... Respiratory Research 2009, 10:52 Introduction Allergic rhinitis and asthma (ARA) are inflammatory diseases and are often associated The lack of control of these diseases is responsible for a significant...
- 9
- 370
- 0
Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg
Ngày tải lên :
20/12/2015, 08:14
... spaces,” Journal of the Mathematical Society of Japan, vol 2, pp 64–66, 1950 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical Society, ... “Classes of transformations and bordering transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 P G˘avrut a, A generalization of the Hyers-Ulam-Rassias stability ... stability of approximately additive mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 L C˘adariu and V Radu, “On the stability of the Cauchy functional equation:...
- 10
- 296
- 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
Ngày tải lên :
20/02/2014, 12:20
... no gold standard available Luckily, the Bayesian approach allows us to automatically select values for the hyperparameters by treating them as additional variables in the model We augment the ... this paper, we have demonstrated that, for a standard trigram HMM, taking a Bayesian approach to POS tagging dramatically improves performance over maximum-likelihood estimation Integrating over ... not always reasonable to assume that a large tag dictionary is available To determine the effects of reduced or absent dictionary information, we ran a set of experiments inspired by those of Smith...
- 8
- 523
- 0
Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot
Ngày tải lên :
22/02/2014, 09:20
... prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either close a previously opened adjective phrase and continue an already ... of the T-tag look up procedure against samples of the corpus that have been manually parsed accordiug to the rules contained in the Case Law Manual ~here alternative T-tags are assigned for any ... schematic diagram: WORD TAGGED CORPUS -~ T-TAG A~ IGNFLENT (PARTIAL PARSE) -~ BRACKET CLOSING AND T-TAG SELECTION - ~ CONSTITUENT ANALYSIS Phrasal ,nd clausal categories and boundaries are assigned...
- 7
- 529
- 0
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
Ngày tải lên :
07/03/2014, 06:20
... database (release 48.8) with fixed carbamidomethyl modification of cysteine residues, variable oxidation of methionine and variable deamidation of asparagine and glutamine Parent and fragment mass ... Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total 1 2 3 4 All All All ... oxidase activity [26] Hence, we may speculate that hmeprin has activity similar to BMP-1 ⁄ TLD-like metalloendopeptidases in that it acts as a procollagen C protease as well as an activator of...
- 20
- 506
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...
- 11
- 731
- 0
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf
Ngày tải lên :
07/03/2014, 18:20
... Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, pages 173–180, Stroudsburg, PA, USA Proceedings of ACL James Clarke and Mirella Lapata 2008 Global inference ... material are those of the authors and not necessarily reflect the views of DARPA or NSF References Eugene Charniak and Mark Johnson 2005 Coarse -to ne n-best parsing and maxent discriminative reranking ... The absolute difference of the compression ratio of the candidate sentence with that of the first ranked candidate This is because we try to avoid a very large or small compression ratio, and...
- 5
- 425
- 1
Báo cáo khoa học: "A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants" docx
Ngày tải lên :
08/03/2014, 02:21
... essential in bootstrapping to evaluate the quality of the patterns automatically IE and QA approaches, due to uniqueness assumptions of the real-world relations that these methods search for, have an ... Constructing semantic space models from parsed corpora In Proc of ACL Chris D Paice 1981 The automatic generation of literary abstracts: an approach based on the identification of self-indicating phrases ... they have two core concepts and a syntactic and semantic Human evaluation We next perform two human experiments to indirectly evaluate the quality of the automatically generated cue phrase variants...
- 8
- 499
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Council of Canada [1] Reduplication is a word formation process involving the repetition of a word or a part of a word As an example, in Warlpiri there is a process of nominal reduplication to form ... here, although designed and implemented for Warlpiri, is intended to be a general approach to morphological parsing A number of extensions can easily be made and a number of design improvements are...
- 8
- 522
- 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf
Ngày tải lên :
08/03/2014, 21:20
... Hyderabad, India, January William A Woods 1970 Transition network grammars for natural language analysis Communications of the ACM, 13(10):591–606, October Gerald Gazdar 1988 Applicability of indexed ... grammar: An approach to gap resolution in analytic-language translation In Proceedings of The Third International Joint Conference on Natural Language Processing, volume 1, pages 80–87, Hyderabad, ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers and the gaps are...
- 9
- 572
- 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt
Ngày tải lên :
17/03/2014, 10:20
... scans, 512 K data points was collected The spectrum was calibrated using a dataset of a sample of standard peptides After calibration, the masses of the standard peptides differed by maximum 1.1 ... pellet was discarded and a sample of the supernatant was withdrawn for radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which ... electron-capture dissociation for the analysis of protein enzymatic digests Rapid Commun Mass Spectrom 16, 993–998 Tanaka, Y., Sato, I., Iwai, C., Kosaka, T., Ikeda, T & Nakamura, T (2001) Identification...
- 7
- 491
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
Ngày tải lên :
23/03/2014, 14:20
... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... annotators agreed on the annotation of this dimension Table shows the micro and macro-average of the percentage of cases in which at least annotators have labeled the ingredients as appropriate (APP),...
- 9
- 518
- 0
Báo cáo khoa học: "A SITUATION SEMANTICS APPROACH TO THE ANALYSIS OF SPEECH ACTS" ppt
Ngày tải lên :
24/03/2014, 01:21
... possible to give a syntactic definition of a speech act, how can the notion of speech acts be integrated into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative ... properties, statement ON SITUATION-TYPES There are various ways that a word or phrase can count as an operation on a situation-type For example, an utterance or part of an utterance could (a) take a whole ... situations, beliefs about situations, natural language descriptions -of situations, cte are actually situation-typeS, which arc partial functions characterizing various types of situattons (Cf Barwise (198I)...
- 4
- 489
- 0
Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc
Ngày tải lên :
24/03/2014, 03:20
... this level of success as an indication of the feasibility of our data-driven, modular approach Additionally, our approach has the advantage of wide coverage Since it does not require an extensive ... depth: WH cat: WTI lea: join cat: mother cat: daughter catl: daughter cat2: daughter cat3: daughter cat4: daughter cat5: daughter cat6: - daughter cat7: GAP-3 WHADVP why SBARQ VP VB SBAR SBAR UNDEFINED ... Data The data on which the classifiers are trained and tested is an extract of 7915 sentences from the Penn Treebank (Marcus et al., 1993), which are tagged to indicate the location of WH gaps...
- 4
- 614
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
Ngày tải lên :
10/06/2014, 21:42
... this use of sacrificial imagery ‘implies a replacement of ritual sacrifice and indicates an assumption that the death of Jesus had been a final sacrifice to end all sacrifices’ (Romans 16 (Dallas, Tex.: ... the story of the multiplication of the loaves and fishes with language that points ahead to the priestly action of Jesus at the Last Supper Mark writes of Jesus assuming a posture of prayer and ... Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With of ces in Argentina Austria Brazil Chile Czech Republic France...
- 322
- 436
- 0
princeton university press religious experience reconsidered a building-block approach to the study of religion and other special things oct 2009
Ngày tải lên :
11/06/2014, 12:43
... I argue that scholars can situate what people characterize as religious, spiritual, mystical, magical, superstitious, and so forth in relation to larger processes of meaning making and valuation, ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... both anomalous and ideal things may tend to stand out for people and that much of what we traditionally associate with religion—for example, spiritual beings and abstract concepts such as transcendence,...
- 229
- 1.5K
- 0