site speci fi c labeling of his tagged nanobodies with 99m tc a practical guide

Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot

Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot

Ngày tải lên : 16/03/2014, 13:20
... re-replication of DNA in eukaryotic cells including human cells [7] Targets of the kinase in the regulation of DNA replication include ORC2, Cdc6 and Mcm proteins in Saccharomyces cerevisiae [8], and ... on identical cells with special reference to cell cycle phases in a chick embryo Exp Cell Res 186, 6–14 32 Tanaka S, Ueda T, Nakajima K & Higashinakagawa T (1996) Replication patterns of repetitive ... Proc Natl Acad Sci USA 93, 12223–12228 10 Fujita M, Yamada C, Tsurumi T, Hanaoka F, Matsuzawa K & Inagaki M (1998) Cell cycle- and chromatin binding state-dependent phosphorylation of human MCM...
  • 16
  • 369
  • 0
Báo cáo khóa học: High level cell-free expression and specific labeling of integral membrane proteins doc

Báo cáo khóa học: High level cell-free expression and specific labeling of integral membrane proteins doc

Ngày tải lên : 30/03/2014, 13:20
... ttt gtc ctc tgc ttt cat taa aac cgg cat atg aca ccg acc ctt tta agt gct ttt tgg cgg aag ctt tta ata gaa aat gcg tac cgc gca ata gac cgg gct agc aac cct tat att tat ctt ggt gg cgg gct agc atg tgg ... aag ctt tta gtg agt gct gag ttt cag acc cgg cat atg aac cct tat att tat ctt ggt ggt gc cgg aag ctt tta atg tgg tgt gct tcg tga c cgg cat atg cag agc gat aaa gtg ctc aat ttg cgg aag ctt tta ttc ... gct tcg tga c cgg gct agc tcc tgg att atc tta gtt att gc gga gct agc gtg agt gct gag ttt cag acc T7-RNA polymerase E coli tRNAb pyruvate kinase amino acids acetyl phosphate phosphoenol pyruvate...
  • 13
  • 318
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Ngày tải lên : 22/02/2014, 07:20
... topoisomerases Histone modifications such as acetylation and phosphorylation play important roles in the regulation of chromatin structure In particular acetylation of the N-terminal tails of histones are ... recombined product (pTRE-RLZ) cotransfected with an expression vector for a phage l integrase mutant was set as 100% In each case, data were collected from six separate transfection assays, each employing ... By comparing the efficiencies of recombination on episomal and on genomic targets, we have shown that the dynamic nature of chromatin renders a site of at least 34 bp in general reactive for recombination...
  • 7
  • 472
  • 0
Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx

Báo cáo khoa học: Active-site-specific chaperone therapy for Fabry disease Yin and Yang of enzyme inhibitors pptx

Ngày tải lên : 30/03/2014, 03:20
... hemizygote with significant residual a- galactosidase A activity Am J Hum Genet 33, 7 1A Nakao S, Takenaka T, Maeda M, Kodama C, Tanaka A, Tahara M, Yoshida A, Kuriyama M, Hayashibe H, Sakuraba H et al ... tolerated in mice ASSC therapy for Fabry disease in humans The clinical proof -of- concept for ASSC therapy has been investigated in cardiac Fabry disease by Frustaci and colleagues [48] Galactose, ... Gaucher disease Proc Natl Acad Sci USA 99, 15428–15433 21 Chang HH, Asano N, Ishii S, Ichikawa Y & Fan JQ (2006) Hydrophilic iminosugar active -site- speci c chaperones increase residual glucocerebrosidase...
  • 10
  • 548
  • 0
Báo cáo khoa học: Site-specific casein kinase 1e-dependent phosphorylation of Dishevelled modulates b-catenin signaling ppt

Báo cáo khoa học: Site-specific casein kinase 1e-dependent phosphorylation of Dishevelled modulates b-catenin signaling ppt

Ngày tải lên : 30/03/2014, 10:20
... Framingham, MA) IMAC columns were first activated with a 100 mm FeCl3 solution (Aldrich, Milwaukee, WI) Samples were loaded onto the IMAC columns and washed with several column volumes of 0.01% acetic ... Series; Santa Clara, CA) directly into a Finnigan LCQ quadrupole ion trap mass spectrometer (Thermo Electron, San Jose, CA) at a flow rate of 60 nLÆmin)1 The nano-flow HPLC gradient used was 0–60% acetonitrile ... Dvl-1 by replacement with acidic residues [13] In particular, a multiple mutant with replacement of threonines 135 and 137, as well as serines 139 and 142, by negatively charged aspartic acid residues...
  • 9
  • 313
  • 0
Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf

Báo cáo khoa học: Comparative analysis of the site-specific N-glycosylation of human lactoferrin produced in maize and tobacco plants pdf

Ngày tải lên : 31/03/2014, 07:20
... contain a remarkably higher level of terminal GlcNAc than the corresponding structures isolated from mLf Significant amounts of compounds (GlcNAc1XylFucMan3GlcNAc2) and (GlcNAc2XylFucMan3GlcNAc2) ... proportion of GlcNAccontaining glycans in tLf mainly reflects differences in N-acetylglucosaminidase activities that govern the biosynthesis of paucimannose-type glycans, after maturation of the N-glycans ... masses of glycine, serine, aspartic acid and carboxamidomethylated cysteine, respectively, amino acid sequence GSDC, that corresponds to the glycosylation site Asn624 Discussion Fig Mass spectrometry...
  • 8
  • 426
  • 0
Báo cáo hóa học: "Research Article Polarimetric Kronecker Separability of Site-Specific Double-Directional Channel in an Urban Macrocellular Environment" pptx

Báo cáo hóa học: "Research Article Polarimetric Kronecker Separability of Site-Specific Double-Directional Channel in an Urban Macrocellular Environment" pptx

Ngày tải lên : 21/06/2014, 22:20
... S Takahashi and Y Yamada, “Propagation-loss prediction using ray tracing with a randomphase technique,” IEICE Transactions on Fundamentals of Electronics, Communications and Computer Sciences, ... of a class of a residual part for classes for residual parts Path spacing 16–21 (varies with streets) 3◦ –5◦ (varies with classes) 14◦ of a class of a residual part for classes for residual parts ... fact that extracted channel parameters are independent of the measurement antennas since the beam patterns of the measurement antennas are taken into account in the multipath parameters extraction...
  • 15
  • 318
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Ngày tải lên : 16/02/2014, 14:20
... that bacitracin is not a selective inhibitor of PDI Instead, bacitracin can also interact with folding polypeptide chains and other molecular chaperones and folding catalysts Bacitracin probably ... [8], concerns have been raised about protease contamination of some commercially available bacitracin preparations [31] Here, we have tested the effect of bacitracin in a variety of in vitro assays ... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused...
  • 9
  • 620
  • 0
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20
... molecular mass and DA of chitosan Muzzarelli et al (1994) compared acetic acid with lactic acid as a chitosan solvent during the nonspeci c chitosanolysis by papain and reported lactic acid to ... [28] Contrary to this, the speci c activity of pronase indicated that chitosan dissolved in aqueous acetic acid (1%) and was the best solvent when compared to formic and lactic acids In acetic acid, ... equilibrated in sodium acetate buffer (pH 4.5) [21] The column was precalibrated with dextrans (of known molecularmass)andchitosanmolecularmassstandards.Fractions I and II obtained after charcoal-Celite...
  • 11
  • 673
  • 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Ngày tải lên : 19/02/2014, 18:20
... resulting plasmid by cloning the following annealed oligonucleotides 5¢-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3¢ and 5¢-CA TGCCAAACGTTCGCGACCGCCCTGACGGCGATTA TCGGAGTTCGGACA-3¢ into ... strategy was used for constructing p13R4-P, except that the following primers 5¢-ACTCATA CTAGTCTTAGCCATGGCTTCCCGCCG GCG-3¢ and 5¢-CCATCCGAATTCTCACTACACATTGATCCTAGCA GAAGC-3¢ were used for the PCR ... 5¢-GTCTGGCGGAA AACCTCAGTGTGACGC-3¢ and 5¢-GACACCAGACCA ACTGGTAATGGTAGCGACCG-3¢ were used for the amplification of the 3¢ end of the b-gal gene The presence of similar amounts of genomic DNA in...
  • 14
  • 483
  • 0
Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Tài liệu Báo cáo Y học: The glucose-specific carrier of the Escherichia coli phosphotransferase system Synthesis of selective inhibitors and inactivation studies pptx

Ngày tải lên : 21/02/2014, 01:21
... biphasic to a monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) of the analogues 1a) 3d was carried out at 30 C Rate ... inactivation by iodoacetamide fits better to an exponential function (Fig 3) as expected of a small nonspeci c reagent with equal access to both Cys Whatever the cause, sensitization by Glc cannot ... constants (min)1) were calculated by nonlinear fit to a first-order decay function of the form: y ¼ A exp(–kinact t) + residual kinact Inhibitor Concn a- Haloester analogues 1ac 1b 30 1cc 3b IAcNH2...
  • 12
  • 720
  • 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx

Ngày tải lên : 21/02/2014, 15:20
... primers 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢ HindIII–BamHI digested PCR product was cloned into the pBlueScript SKvector and then recloned by KpnI–BamHI into ... whole CK 2a ORF region was amplified from Drosophila genomic DNA using the following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI ... following pair of primers: 5¢-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT TGGGATTCATTTGACCA-3¢ (the gene encoding the Drosophila CK2 a subunit does not contain introns in the coding...
  • 10
  • 464
  • 0
Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Báo cáo khoa học: Specific cleavage of the DNase-I binding loop dramatically decreases the thermal stability of actin pot

Ngày tải lên : 06/03/2014, 22:21
... ATPMg-G-actins Fig DSC curves of intact G-actin (A) and ECP-cleaved G-actin (B) with different tightly bound nucleotide and cation: ATP-Ca-Gactin, ATP-Mg-G-actin and ADP-Mg-G-actin The actin concentration ... cleaved G-actins in the Fig Temperature dependences of the excess heat capacity (Cp) of intact (curve 1), ECP-cleaved (curve 2) and subtilisin-cleaved (curve 3) ATP-Ca-G-actins The actin concentration ... step of thermal inactivation of F-actin [28,29] Although both cleaved actins are stabilized with phalloidin and AlF4À , stabilization of ECP-cleaved F-actin demonstrates speci c features that are...
  • 11
  • 482
  • 0
Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Báo cáo khoa học: Stage specific expression of poly(malic acid)-affiliated genes in the life cycle of Physarum polycephalum Spherulin 3b and polymalatase potx

Ngày tải lên : 07/03/2014, 12:20
... NKA48: forward, 5¢-GATGCTAACTTCAGCGGAAAC TC- 3¢; reverse, 5¢-CACGATGATGGATGAAATGGCG TC- 3¢ For NKA49: forward, 5¢-CTTCCACGACGGAAAC GATGAC-3¢; reverse, 5¢-CTCTCCAACACATGCTGACG TAG-3¢ Cycling conditions ... Picard [37] In the case of NKA8, the forward primer was 5¢-GAT GCATAATACGACTCACTATAGGGAGTGCCTTGCAA GGAGTATTG-3¢ and the reverse primer was 5¢-GCCTTC TAATACGACTCACTATAGGGAGCTCGTAATAGCTT TTGGAC-3¢, ... 5¢-GATGCATAATACGACTCACTATAGG GAAATGTCCGTCCAACAAGGAG-3¢ (forward) and 5¢GCCTTCTAATACGACTCACTATAGGGACCACGATG ATGGATGAAATG-3¢ (reverse) Both primers contained T7-polymerase promoter at the 5¢ terminus and were custom-synthesized...
  • 10
  • 639
  • 0
Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Báo cáo khoa học: Specific degradation of H. pylori urease by a catalytic antibody light chain pptx

Ngày tải lên : 07/03/2014, 21:20
... possessed a catalytic capability [14,15,18] Friboulet et al concluded that a catalytic dyad composed of His and Asp was important for the esterase activity of their catalytic anti-idiotypic antibody ... derived from CCR5, a chemokine receptor, which plays a crucial role in HIV infection In all of these catalytic antibodies, a catalytic triad composed of Asp, Ser, and His was always identified through ... parent antibody (41S-2 mAb) was as speci c to the gp41 molecule as 41S-2-L was [10,11] In some cases, a significant change in the immunological character of the heavy or light chain could occur,...
  • 9
  • 388
  • 0
Báo cáo khoa học: Voltage-gated sodium channel isoform-specific effects of pompilidotoxins doc

Báo cáo khoa học: Voltage-gated sodium channel isoform-specific effects of pompilidotoxins doc

Ngày tải lên : 15/03/2014, 10:20
... the isoform The large increase in As was occasionally associated with a smaller increase in Ass The average value of the fast time constant (sf) found in control traces was used as a fixed parameter ... Pompilidotoxins and voltage-gated Nav isoforms Mantegazza M, Gambardella A, Rusconi R, Schiavon E, Annesi F, Cassulini RR, Labate A, Carrideo S, Chifari R, Canevini MP et al (2005) Identification of an Nav1.1 ... of a solitary wasp, facilitates transmission in the crustacean neuromuscular synapse Neurosci Lett 238, 99–102 12 Konno K, Hisada M, Itagaki Y, Naoki H, Kawai N, Miwa A, Yasuhara T & Takayama...
  • 13
  • 364
  • 0
Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Báo cáo khoa học: Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio) docx

Ngày tải lên : 16/03/2014, 00:20
... fabp10b gene of zebrafish A B Venkatachalam et al Table Isoelectric point (pI) of FABP10s in different species Species Protein pI Zebrafish Zebrafish Shark Catfish Lungfish Salamander Toad Iguana Chicken ... physiological roles for FABPs include the uptake and utilization of fatty acids, intracellular targeting of fatty acids to speci c organelles and metabolic pathways, and the protection of cellular structures ... of the zebrafish fabp10b gene Fig Tissue -speci c distribution of fabp10b transcripts in adult zebrafish (A) Zebrafish fabp10b cDNA -speci c primers amplified an RT-PCR product from total RNA extracted...
  • 11
  • 402
  • 0
Báo cáo khoa học: The Janus-faced atracotoxins are specific blockers of invertebrate KCa channels ppt

Báo cáo khoa học: The Janus-faced atracotoxins are specific blockers of invertebrate KCa channels ppt

Ngày tải lên : 16/03/2014, 06:20
... KCa2.x) and intermediate-conductance KCa channels (IKCa channels, KCa3.x) First, the IK(Ca) in cockroach DUM neurons was voltage-activated, like all known BKCa currents, whereas SKCa and IKCa channel ... described earlier Block of IK(Ca) occurred without significant alteration of the A D B E C F Fig J-ACTX-Hv 1c blocks KCa channels in cockroach DUM neurons (A) Typical effects of nM J-ACTX-Hv 1c on IK(Ca), ... (Fig 4A D) Effects on Slowpoke (Slo) channels The above findings suggest that J-ACTX-Hv 1c selectively blocks cockroach BKCa channels rather than small-conductance KCa channels (SKCa channels, KCa2.x)...
  • 15
  • 319
  • 0
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc

Ngày tải lên : 16/03/2014, 10:20
... method of chromatin assembly For chromatin assembly, lg of DNA and rat liver core histones (1 : 1.6 molar ratio of DNA to histones) were incubated with lg of BSA in a 10 lL volume at a final NaCl concentration ... experiments Chromatin assembly Chromatin with regularly spaced nucleosomes in the absence of histone H1 was assembled at an NaCl concentration of 50 mm, using an S-190 extract of Drosophila embryos and ... (N) and chromatin assembly (C) in the presence and absence of the R3 protein Chromatin was assembled with S-190 extract over plasmid pU6lac3 at a monovalent salt concentration of 150 mM Comparison...
  • 15
  • 299
  • 0
Báo cáo khoa học: Hepatocyte-specific interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc

Báo cáo khoa học: Hepatocyte-specific interplay of transcription factors at the far-upstream enhancer of the carbamoylphosphate synthetase gene upon glucocorticoid induction doc

Ngày tải lên : 23/03/2014, 10:20
... TTCTTAAAACTTGACCAAA Primer GGGTACGATGACTAAATGATCGGA Primer TCATCAGCAGCCCTTCTTTGCACAAC (Figs and 5A, B) Primer GACTAAATGATCGGATACGTGCCCATTCT (Figs and 5C) Lower strand Primer CTCAACGTCATTCTAAAGT Primer ... EMSA, electrophoretic mobility shift assay Probes and primers (5¢- to 3¢) Probes for EMSA C ⁄ EBP TTTCGAGTCTTGCAAAATCATCA FoxA CATCAGTGTTTGCTCTTGACAAG LM-PCR primers Upper strand Primer TTCTTAAAACTTGACCAAA ... Primer ACAACATACTTCGAAACTGTGACC Primer TGTCCTGGCACATGACCCGGATCA h before the start of the experiment DNaseI treatment was performed exactly as previously described [27] Dimethylsulfate treatment Cells...
  • 9
  • 429
  • 0