simulation of a fixed bed adsorber with a stochastic model in the case of the linear isotherm
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
Ngày tải lên :
25/10/2012, 11:18
... results of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... a bolus dose of unfractionated heparin (100 U/kg) was injected through the femoral or radial artery sheath, with repeated boli administered as needed to maintain activated and clotting time of...
- 6
- 550
- 0
Chronicles of a Dallas Cowboys Fan: Growing Up With America''''s Team in the 1960''''s by John Eisenberg pptx
Ngày tải lên :
14/03/2014, 17:20
... Conference was not integrated, and the idea of paying to watch blacks play football sat uneasily in many fans‘ minds Within days of the announcement that the team was coming, a Dallas Morning News ... Most of the players were average in the early days and largely unknown outside Dallas, but in my parochialism I saw them bathed in the bright lights of stardom There was Amos Marsh, the talented ... was a Texas League baseball team that played at Burnett Field in South Dallas Later on, there was another Texas League team, the Dallas-Fort Worth Spurs, who played at Turnpike Stadium in Arlington...
- 18
- 466
- 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx
Ngày tải lên :
23/03/2014, 03:20
... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... Perera et al 3498 25 25 25 25 27 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 acids ⁄ 14 amino amino amino amino amino 15 15 15 15 15 acids acids acids acids acids amino amino amino amino amino acids ... reliability Backbone conformation was evaluated by the inspection of the Psi ⁄ Phi Ramachandran plot obtained from procheck analysis [36] Packing quality of the 3D model was investigated by the calculation...
- 13
- 474
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
Ngày tải lên :
28/03/2014, 15:20
... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... simulation of the wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the ... when waves are breaking, a major part of the lost wave energy is dissipated directly in the shear layer beneath the surface roller, and only a minor part of it is transformed into turbulent ...
- 11
- 460
- 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
Ngày tải lên :
29/03/2014, 00:20
... diadenosine pentaphosphate, a blocker of adenylate kinase) was measured by exploiting the differential affinity of ADP and ATP for Mg2+ The rate of ATP appearance in the medium following addition of ADP ... static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared with ... species, including the deletions of four amino acids Finally, we show that the ADP–ATP exchange rate mediated by ANT expressed in mitochondria of A franciscana and Ca2+ uptake capacity are insensitive...
- 15
- 505
- 0
Báo cáo hóa học: " Prevalence of the GJB2 IVS1+1G A mutation in Chinese hearing loss patients with monoallelic pathogenic mutation in the coding region of GJB2" pot
Ngày tải lên :
18/06/2014, 16:20
... profound bilateral sensorineural hearing impairment on audiograms Careful medical examinations revealed no clinical features other than hearing impairment DNA was extracted from the peripheral ... located in the basal promoter of the gene, in trans with V84M, in a patient with profound hearing impairment They verified that the -3438C>T mutation can abolish the basal promoter activity of ... Brownstein Z, Marlin S, Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP, Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat M, Abeliovich D, Dahl HH, Estivill X, Gasparini...
- 7
- 695
- 0
Báo cáo hóa học: " On calculation of eigenvalues and eigenfunctions of a Sturm-Liouville type problem with retarded argument which contains a spectral parameter in the boundary condition" pot
Ngày tải lên :
20/06/2014, 22:20
... Establishment of the problem belongs to AB (advisor) ES obtained the asymptotic formulas for eigenvalues and eigenfunctions All authors read and approved the final manuscript Competing interests The authors ... retardation obtained Şen and Bayramov Journal of Inequalities and Applications 2011, 2011:113 http://www.journalofinequalitiesandapplications.com/content/2011/1/113 Authors’ contributions Establishment ... differential equation with retarded argument, Izv Vysś.Ućebn Zaved Matematika 6(7), 203–214 (1958) Norkin, SB: Differential equations of the second order with retarded argument Translations of Mathematical...
- 9
- 410
- 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
Ngày tải lên :
08/08/2014, 01:21
... class reduction (AGC single value) Abrupt growth change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the ... Most of the bogs in Switzerland have been drained and cut mainly between the 18th and the middle of the 20th century Drainage of peat bogs can trigger bog pine invasion and affect the structure of ... the age of pine of LV1 and LV2, indicating a clear gradient for height, diameter and mean annual apical growth from Figure Duration curves of the ground-water table in the three subplots of the...
- 10
- 277
- 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 06:22
... research on the interaction of RA-IgG and RASFs as well as other recent data, however, may change the picture It has been reported by Huizinga and colleagues that in a cohort of patients with recent ... destruction Although a number of molecular pathways have been identified that contribute to the stable activation of RASFs, the precise cause and nature of this activation, as well as its relevance and ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and...
- 3
- 222
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
Ngày tải lên :
09/08/2014, 07:20
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 ... FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 VIC- TCGGGAGTTCGAGACC-MGB SNP5R ACACAGGGTTTCACCATGCT SNP5 allele2 FAM- CGGGAGTTGGAGACC-MGB SNP6F TCCCTACTGTTGTTTCCGCC SNP6 allele1VIC-TGAAGACCCTGGGC-MGB...
- 9
- 559
- 0
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
Ngày tải lên :
09/08/2014, 18:21
... T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T ... discovery of a SNP that adds an extra cysteine into the amino acid sequence of leptin, combined with a signicant association to carcass fat measurements and signicant variation in the level of mRNA detected ... levels in cattle Regression analysis (not shown) revealed that the thymine allele was associated with fatter carcasses and the C allele with leaner carcasses This is similar to our nding with the...
- 12
- 321
- 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot
Ngày tải lên :
10/08/2014, 09:22
... done as a previous palliative procedure In all of these patients a VSD was present In patients there was pulmonary stenosis and in a pulmonary atresia In of them an ASD was present In all patients ... patient had a dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac ... CCTGA [30] Although the information in our study was incomplete, a word of caution may be relevant with regard to an increased incidence of abnormal anatomy of the proximal coronary arteries Page...
- 7
- 387
- 0
Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf
Ngày tải lên :
12/08/2014, 01:22
... Ruiz-Medrano R: An iteron-related domain is associated to motif in the replication proteins of geminiviruses: identification of potential interacting amino acid-base pairs by a comparative approach Arch ... EditSeq (DNASTAR Inc., Madison, WI) Paired alignments were obtained by the ClustalV and ClustalW methods in the MegAlign application of the Lasergene package (DNASTAR), using the default parameters ... maintaining the proper matching of cis- and trans-acting replication determinants in the recombinant DNA -A component Diverse studies have identified the sequences encompassing the viral strand...
- 15
- 694
- 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx
Ngày tải lên :
13/08/2014, 16:21
... actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
- 9
- 372
- 0
THE ACOUSTOMAGNETOELECTRIC CURRENT OF a RECT ANGULAR QUANTUM WIRE WITH AN INFINITE POTENTIAL IN THE PRESENCE OF AN EXTERNAL MAGNETIC FIELD
Ngày tải lên :
30/10/2015, 20:58
... understand the properties of quantum wire material We have obtained the AME current I in the RQW with an infinite potential in the presence of an external magnetic field The dependence of the expression ... the AME current I on acoustic wave numbers qz and on the parameters of the RQW with an infinite potential has been shown Numerical calculations are carried out with a specific GaAs rectangular ... in the quantum wire the AME current is non -linear with the acoustic wave number qz These results are compared with those obtained in the superlattices [15, 16], the AME current have a non-linear...
- 7
- 216
- 0
Focus - A simplicity manifesto in the Age of Distraction
Ngày tải lên :
05/01/2014, 15:25
... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... general idea Again, start with half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse, ... these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what the results are In most cases the actual harm will...
- 121
- 552
- 1
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
Ngày tải lên :
21/02/2014, 01:21
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... of total amino acids) Previous studies with regard to soluble organic matrix of mollusk shells indicated that more than 80% of the aspartate and glutamate is in the form of aspartic and glutamic ... separation is indicated by an asterisk content of WSM was rather similar to that of EDTA-IM In spite of the presence of mineral, it was possible to analyze the amino acid composition of the water insoluble...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
Ngày tải lên :
21/02/2014, 03:20
... When the assay contained valinomycin, the data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase ... the data obtained in the absence of Du (C) The ratio of the best-fitting functions and of the data points of wild-type over mutant are plotted for data in the presence (d) and absence (m) of Du ... wild-type at every DpH tested Figure 3B is an enlarged view of Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
Ngày tải lên :
21/02/2014, 08:20
... had acquired at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy ... necessary for the arrival of the captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for ... several days, working on a mule path "cut-off" from the main road "January 14th The mule path was infamous No wagon had ever traveled that road the rancheros have a tradition of a bull cart that,...
- 48
- 504
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Ngày tải lên :
07/03/2014, 12:20
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...
- 16
- 397
- 0