shopping for a t shirt
T-Shirts and Suits A Guide to the Business of Creativity pptx
Ngày tải lên :
15/03/2014, 21:20
... literature By adopting an attitude to customers as partners rather than passive targets, interactive forms of marketing come to mind For example websites that people can engage with (not just ... Chairman of Shanghaibased computer games manufacturer Shanda Entertainment, operates in a culture where pirating software is rife Software pirating was a threat but he turned it into an opportunity ... just read) and printed materials that invite a response all treat customers as active participants Rather than thinking of expensive and relatively untargeted mass marketing (which in any case would...
- 117
- 486
- 0
Don’t Be Taken for a Ride Guide to Auto Leasing pdf
Ngày tải lên :
16/03/2014, 12:20
... it is less expensive to contract for the additional miles before the contract is signed, than to pay a charge that is calculated per mile after the lease is terminated Determine the amount that ... condition report with both your signature and that of the representative accepting the car, the mileage clearly stated, and a detailed review of the condition of the car at the time that you turn ... lubrication It is typically an after-sell item that requires an additional fee incorporated in the overall lease price or capital cost You can negotiate the cost of the maintenance agreement with the...
- 29
- 503
- 0
BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx
Ngày tải lên :
30/03/2014, 10:20
... satisfactory quality TAKE CHARGE OF YOUR VISIT TO A GARAGE MAKING COMPLAINTS If you have a complaint, raise it with the garage as soon as possible It’s only fair that they have a chance to deal with ... correct and that it has been correctly stamped The service record book has been stamped with the garage’s stamp and that the relevant details of the service are correct Rather than replacing parts ... AA www.theaa.com Trading Standards Trading Standards services are provided by your local authority For contact details of your local department see your phone book or go to: www.tradingstandards.gov.uk...
- 14
- 352
- 0
Báo cáo hóa học: " Research Article A T-S Fuzzy Model-Based Adaptive Exponential Synchronization Method for Uncertain " docx
Ngày tải lên :
21/06/2014, 07:20
... errors The estimate φ1 t of the uncertain parameter φ1 is illustrated at Figure 3, which shows that the estimate φ1 t approaches rapidly to target value 8/3 Simulation results reveal that the response ... situation motivates our present investigation Motivated by the above discussions, the aim of this paper is to investigate the fuzzy adaptive exponential synchronization problem for time delayed ... illustrate the effectiveness of the proposed scheme Finally, the proposed synchronization method has the advantage that it can be effectively used to adaptive exponential control and synchronization...
- 14
- 270
- 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Weighted p t -Laplacian System Multipoint Boundary Value Problems" doc
Ngày tải lên :
22/06/2014, 03:20
... Journal of Inequalities and Applications The study of differential equations and variational problems with variable exponent growth conditions is a new and interesting topic Many results have been ... βi 1− −1 t, w t a −1 a h t m−2 i αi h t dt dt − e1 2.14 Journal of Inequalities and Applications From Lemma 2.1, it is immediate that Λh a1 − Λh a2 , a1 − a2 > 0, for a1 / a2 , 2.15 and hence, ... is a solution of 2.4 with 1.2 , by integrating 2.4 from to t, we find that t w t ϕ t, u t w ϕ 0, u g s ds 2.5 Denote a w ϕ 0, u It is easy to see that a is dependent on g t Define operator t g...
- 18
- 222
- 0
Báo cáo y học: "Recently published papers: Clunk-click every trip, smile, but don’t stop for a drink on the way" ppt
Ngày tải lên :
12/08/2014, 20:20
... critically ill medical patients projected to need ventilatory support for more than 14 days to either early percutaneous dilational tracheotomy within 48 hours or delayed tracheotomy at days ... plus a maximum of four intratracheal doses of a recombinant surfactant protein C-based surfactant given within 24 hours They failed to demonstrate any difference between control and treatment groups ... ventilatory support be, particularly during the first 48 hours? We hope that Tracman, the multicentre UK trial that expects to recruit more than 1200 patients, will provide more answers Spragg and...
- 3
- 317
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
Ngày tải lên :
13/08/2014, 01:20
... member KLRD1L gtgggagaatggctctgc KLRD1R tttgtattaaaagtttcaaatgatgga BDLvsLTNP CD8 2.5 2.1 IRS2 NM_003749.2 insulin receptor substrate IRS2L tgacttcttgtcccaccactt IRS2R catcctggtgataaagccaga CD8 3.8 ... ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt BDLvsVIR CD8 -1.3 -2.2 ATP6V1D NM_015994.2 ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR ... gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 Wu et al Retrovirology 2011, 8:18 http://www.retrovirology.com/content/8/1/18...
- 21
- 376
- 0
Báo cáo y học: " CD45 immunoaffinity depletion of vesicles from Jurkat T cells demonstrates that exosomes contain CD45: no evidence for a distinct exosome/HIV-1 budding pathway" doc
Ngày tải lên :
13/08/2014, 05:21
... revealed by stripping and staining the blot with capsid (CA) antiserum: the treated samples had somewhat less intense staining CA bands than the untreated material Similarly, the bead fractions ... fractions had CA signal, though at a lower intensity than either the treated or untreated samples, indicating that some CA was removed by depletion, likely due to virus/vesicle aggregates that are formed ... induce the production of vesicles that lack CD45, though this has not been observed It is important to note that, absolute biochemical purity of virion preparations may not be practically attainable...
- 5
- 221
- 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
Ngày tải lên :
13/08/2014, 05:21
... characterization of such an adapted strain could greatly facilitate the identification of host determinants that are critical regulators of late phase-steps of HIV replication Methods Animals The ... identified by PCR amplification of a hCycT1-specific sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for ... macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 to exploit a distinct set of nuclear transcription factors and alternative mechanisms...
- 19
- 263
- 0
Báo cáo y học: " PDZ domain-binding motif of human T-cell leukemia virus type 1 Tax oncoprotein is essential for the interleukin 2 independent growth induction of a T-cell line" ppsx
Ngày tải lên :
13/08/2014, 09:21
... found that Tax1 and Tax2 transform a rat fibroblast cell line (Rat-1) to induce colonies in soft agar (CFSA, colony formation in soft agar), and the activity of Tax1 is greater than that of Tax2 ... Acknowledgements We thank William W Hall for donating the Tax2B plasmid and the antibody against Tax2B We thank the Takeda pharmaceutical company for providing recombinant human IL-2 We also thank Sayoko Takizawa ... human Thus, it is important to consider such proteins as candidates to mediate Tax1 activity in HTLV-1-infected T- cells We recently showed that Tax2, through the activation of transcription factor...
- 7
- 177
- 0
A Guide to Effec tive Assessmen t and Instruc t ion for A l l Studen ts, Kindergar ten to Grade 12
Ngày tải lên :
15/08/2016, 16:00
... differentiate teaching and learning activities It acknowledges that individual students learn in idiosyncratic ways, but it also recognizes that there are predictable patterns and pathways that many ... indicate that Collaborative Inquiry for Learning in Mathematics (CIL-M) – an initiative of the Ontario Literacy and Numeracy Secretariat that involves teachers, consultants, and superintendents ... interests and attitudes This information establishes the starting point for new learning, and helps teachers and students set appropriate learning goals It enables teachers to plan instruction and assessments...
- 74
- 632
- 0
Write a report for a university lecturer describing the information in the graphs below
Ngày tải lên :
04/10/2012, 10:02
... model answer: The graphs compare the number of deaths caused by six diseases in Someland in 1990 with the amount of research funding allocated to each of those diseases It can be clearly seen that ... deaths from leprosy, 0.3 million deaths from tropical diseases, 0.5 million deaths from diarrhoea, 0.4 million deaths from malaria and 1.8 million deaths from TB These figures can be contrasted ... seen that the amount of research funding in many cases did not correlate with the seriousness of the disease in terms of numbers of deaths In 1990 there were around 0.2 million deaths from AIDS,...
- 2
- 1.6K
- 0
Write a report for a university lecturer describing the information in the two graphs below
Ngày tải lên :
04/10/2012, 10:02
... to postgraduate studies At the other end of the scale we can see that by 1995 all girls were completing lower secondary, although 10% ended their schooling at this point This is in stark contrast ... studies This situation had changed radically by 1995 In 1995, 90% of women in Someland had completed secondary education and of those, half had graduated from an initial degree and 20% had ... contrast with 1945 when only 30% of girls completed primary school, 35% had no schooling at all and 35% only completed the third grade In conclusion, we can see that in the 50 years from 1945 to...
- 2
- 1.6K
- 2
Business Plan for a Startup Business
Ngày tải lên :
23/10/2012, 15:46
... Reputation Location Appearance Sales Method Credit Policies Advertising Image Now, write a short paragraph stating your competitive advantages and disadvantages Niche Now that you have systematically ... difference between features and benefits, and think about them For example, a house that gives shelter and lasts a long time is made with certain materials and to a certain design; those are its features ... estimate the importance of each competitive factor to the customer = critical; = not very important Table 1: Competitive Analysis FACTOR Products Price Me Strength Weakness Competitor A Competitor...
- 27
- 903
- 10
Báo cáo y học: "In-flight medical emergencies: time for a registry"
Ngày tải lên :
25/10/2012, 10:06
... medical kit for commercial airlines: an update Aviat Space Environ Med 2007, 78: 1170-1171 European Joint Aviation Authorities: JAR-OPS1, Commercial Air Transportation (Aeroplanes), Global Engineering ... Competing interests The author declares that they have no competing interests References Sand M, Bechara FG, Sand D, Mann B: Surgical and medical emergencies on board European aircraft: a retrospective ... Critical Care Vol 13 No Ruskin aerospace medical researchers, and the traveling public Sand and colleagues’ study should serve as a template for future research in this important area Competing...
- 2
- 360
- 0
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"
Ngày tải lên :
26/10/2012, 09:39
... transcripts tended to increase after the 8th administration of WT1 peptides Referring to a report that the tetramer binding capacity and specific cytotoxicity of the CTL line decreases remarkably by the ... administration Although bcr-abl transcripts increased considerably after the 12th administration of WT1 peptides, there was a gradual decrease of the transcripts thereafter to the level of complete ... 40 6a 27 Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama...
- 10
- 739
- 0
Hiiriing_ For A Perfect Fiit.
Ngày tải lên :
06/11/2012, 15:40
... Representatives That Are A Perfect Fit Chapter Five Hiring Sales Representatives That Are A Perfect Fit Chapter Six Hiring Sales Managers That Are A Perfect Fit Chapter Seven Hiring Department Managers ... dependable and will easily adapt to the ever-present changes that befall a department manager Click here for additional help with evaluating department managers Page 18 Hiring… For A Pe rfe ct Fit ... Executives are people who have an uncanny ability to grasp and understand long-term goals and broad ideas and to communicate them to others They are dreamers whose creative and analytical attributes...
- 19
- 366
- 1