set the search path for modules this has a format similar to the csh path

Tài liệu The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice Second Edition pptx

Ngày tải lên : 15/02/2014, 02:20

... publicly to thank him and Paula for their service and sacriﬁce for all of us And for Barbara To my sons, Ryan and Jason, and stepsons, Glenn and Chandler, you have my thanks and Barbara’s for becoming ... E-Mail Today, many therapists offer e-mail counseling either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many ... would be a rare circumstance whereby an attorney would have to report a therapist for an ethical mistake or violation We have always made ourselves available for consultation when a mental health...

577
4.7K
0

The Portable Ethicist for Mental Health Professionals A Complete Guide to Responsible Practice pot

Ngày tải lên : 23/03/2014, 06:20

... publicly to thank him and Paula for their service and sacriﬁce for all of us And for Barbara To my sons, Ryan and Jason, and stepsons, Glenn and Chandler, you have my thanks and Barbara’s for becoming ... E-Mail Today, many therapists offer e-mail counseling either as a primary form of therapy or as an adjunct to regular therapy sessions E-mail therapy began as a matter of convenience for many ... would be a rare circumstance whereby an attorney would have to report a therapist for an ethical mistake or violation We have always made ourselves available for consultation when a mental health...

577
2.5K
0

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Ngày tải lên : 24/03/2014, 04:21

... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... to the Stanford Human Genome Center Radiation Hybrid Mapping Server, where it was subjected to a twopoint statistical analysis against 15632 reference markers This yielded a linkage to two markers, ... signiﬁcant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro-inﬂammatory agents Activated eosinophils, neutrophils, macrophages and lymphocytes...

14
540
0

Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps

Ngày tải lên : 11/08/2014, 08:20

... who had no preexisting CAD Collaborative Atorvastatin Diabetes Study (CARDS) was carried out to evaluate the efficacy and safety of low-dose atorvastatin treatment in primary prevention of CAD ... events in patients with diabetes, whether they already had CAD or not In the ASCOT-LLA trial [10] atorvastatin did not reduce the risk of non-fatal MI and CAD death in patients with diabetes and hypertension ... implementation of a Cardiac Hospitalization Atherosclerosis Management Program (CHAMP) Am J Cardiol 2001, 87:819-822 170 Chandra KK, Malhotra S, Gupta M, et al.: Changing trends in the hospital management...

12
346
0

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Ngày tải lên : 16/03/2014, 14:20

... during the vitellogenic period, and then peaks one day after the blood meal [24] This particular pattern is surely related to the haematophagous regime and anautogenic features of this species The ... gonadotrophic cycle and the period of ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the ... species For example, RNAi has been used in the cockroach P americana to analyze the function of the homeotic gene engrailed in relation to the control of axon path nding and synaptic target choice...

11
414
0

Báo cáo khoa học: Saccharomyces cerevisiae a1,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule ppt

Ngày tải lên : 23/03/2014, 10:20

... CTATGCTTTTGAA-3¢) and D18 8A- RV (5¢-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3¢), and the pPICZaA-ScOCH1 as a template The both D18 8A mutant and wild-type proteins were expressed as mentioned above After the ... that the contaminants may have a catalytic activity only toward the substrate (Man10GlcNAc2PA), where the ﬁrst mannose was added to Man9GlcNAc2-PA, we puriﬁed Man10GlcNAc2-PA and used it as an acceptor, ... Materials The Pichia pastoris expression kit was purchased from Invitrogen Corp (Carlsbad, CA, USA) a1 ,2-Mannosidase (Aspergillus saitoi) was from Seikagaku Corp (Tokyo, Japan) a1 ,6-Mannosidase...

12
251
0

look at the important information in this header.1look at the important information in this header.We encourage you to keep this file on your own disk, keeping an electronic path open for the next readers. Do not remove this. **Welcome To The World o doc

Ngày tải lên : 06/03/2014, 23:21

... text, and was indignant at the idea of her daughter marrying a waiter! Things had arrived at this crisis when Casimir's mother, Madame Dudevant, who had all the manners of a Information prepared ... had taken to drink, in company with Hippolyte Chatiron, and it seems that the intoxication peculiar to the natives of Berry takes a heavy and not a gay form He had also taken to other bad habits, ... seems to him a pleasant place for a suicide There was a magnificent horizon there; then, too, there was a precipice and a waterfall Ralph's happy ideas are somewhat sinister, but the couple set...

94
670
0

The Nontraditional Path - Help for Non-Education Majors and Those Returning to the Field

Ngày tải lên : 25/10/2013, 16:20

... career, been a friend to a neighbor in need, or served as an amateur paramedic at the scene of an accident Actually, any career experience you’ve had to date involves skills and talents that are ... undergraduate background in math, science, or Spanish North Carolina is another excellent example of a state that’s had to develop an innovative program to train more teachers They have started ... Jose, California, for example, has a program called the Teaching Fellows Program that provides coaching and mentors to work with career switchers who have B .A. s in other fields Jennifer, a former...

9
396
0

Search Guide for the NTIS Database ppt

Ngày tải lên : 07/03/2014, 23:20

... connectors To save search strategy for days To save search strategy permanently To run a saved search To save a search for 30 minutes To list search saves To purge search saves To explain system ... media sent to online database vendors, and other organizations that lease the database from NTIS for internal use Each vendor has a unique load of the NTIS Database and the placement of the ﬁelds ... are available from NTIS for almost 90 percent of the titles announced on the database There are more than 600,000 titles available in digital format Leasing the NTIS Database Organizations making...

90
405
0

Helping Older Adults Search for Health Information Online A Toolkit for Trainers from the National Institute on Aging potx

Ngày tải lên : 29/03/2014, 19:20

... prevention, for example) Type this term into your search box and ask your students to the same Show them how to left-click the blue search button to the right of the box Maria’s Mother “Maria’s mother ... Go to www.nia.nih.gov To download Toolkit materials, go to www.nihseniorhealth.gov/toolkit 20 Helping Older Adults Search for Health Information Online: A Toolkit for Trainers from the National ... difficult it was for them to move back and forth on the site Doing a Shallow Search • Click on a link just once • View the page, and then click on the back button to return to the original page Module...

42
344
0

Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx

Ngày tải lên : 09/08/2014, 07:20

... was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and VIC™ (the T allele) and the 3' ends contained quenchers and minor groove binders The probe for the A allele ... This is the first study to show an association between the PTPN22 1858T variant and a disease related autoantibody, and that they co-operate to increase the relative risk of developing an autoimmune ... between the PTPN22 1858T variant and future development of RA This association is stronger than that for HLA-SE and is the better predictor for RA We also show an association between the T variant and...

6
322
0

Báo cáo y học: "Reducing the exome search space for Mendelian diseases using genetic linkage analysis of exome genotypes" ppsx

Ngày tải lên : 09/08/2014, 23:20

... analysis We adapted our existing software [35] to extract HapMap Phase II SNP genotypes from WES data and format them for linkage analysis We anticipated two potential disadvantages to this approach ... The denominator for percentages is the total number of HapMap Phase II SNPs in that distance category more variable inter-marker distances than the genotyping arrays, with a smaller median value ... used to extract genotypes from VCF files and format them for linkage analysis are freely available on our website [46], as is the annotation file for HapMap Phase II SNPs Users may also download...

9
318
0

báo cáo khoa học: " The first set of EST resource for gene discovery and marker development in pigeonpea (Cajanus cajan L.)" ppsx

Ngày tải lên : 12/08/2014, 03:21

... UG-III and UG-IV were analyzed for BLASTN similarity search against available EST datasets of legume species namely chickpea (Cicer arietinum), pigeonpea (Cajanus cajan), soybean (Glycine max), ... Details of BLASTX and BLASTN analyses against UniProt database for all four unigene sets are provided in Additional files 2, 3, and Table BLASTN analyses of pigeonpea unigenes against legume and ... sterility mosaic virus (PPSMV) and transmitted by an eriophyid mite Aceria cajani Channabasavanna [7] The disease slowly spreads into the vascular tissues from the aerial parts through mite population...

22
365
0

A combinatorial approach to the search for anticonvulsant agents from gou teng and tian ma

Ngày tải lên : 11/09/2015, 21:27

... oxindole alkaloids (POA) and tetracyclic oxindole alkaloids (TOA) Wurm et al 35afound that it was the POA instead of the TOA that induced human endothelial cells to release a regulating factor responsible ... alkaloidal extract with regard to the number, character and quantity of alkaloids Without this analysis on the fraction as a means of quality control, it would be too premature to regard it as an ... can be generated with less effort than natural products has diverted the attention of large pharmaceutical companies; third, the decision-makers in the large pharmaceutical companies has placed...

195
529
0

Development of some local search methods for solving the vehicle routing problem

Ngày tải lên : 04/10/2015, 15:58

... during the enumeration phase because the cutting plane phase and the enumeration phase are completely separated and the enumeration process has to be repeated from scratch if the branch and bound algorithm ... problem and has been the focus of operations researchers and combinatorial analysts for many years Many exact and approximate methods have been proposed to solve the VRP in recent years In this chapter, ... location, and therefore, the current load of the vehicle before arriving at a given location can be calculated by the initial load minus all the demands already delivered plus all the demands already...

123
363
0

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Ngày tải lên : 25/10/2012, 10:45

... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... to collect valid data at the herd level They perceive the collection of the data in and of itself as the basis for taking relevant action at the farm They may skip the process of systematic analysis ... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the...

10
587
0

18 Selection plan for marketing team of risingstar s213 touch phone. How to build a winning team to successfully accomplish the project

Ngày tải lên : 03/04/2013, 12:11

... has their own role which affirms their position The most suitable way to encourage members is empowerment The manager has to have empowerment from the top of company to have all power about this ... team, if they have good relationship, this team can achieve its goal faster and better and inverse It is easy to realize that these relationships affect to both manager and team members, so they ... separate works which are planning, research, implementation, control and evaluation The characteristics of candidates who apply for team have to meet the characteristic of these works Firstly, the...

12
505
0

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Ngày tải lên : 05/09/2013, 09:38

... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated sludge samples were quantified ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified...

7
719
0