0

set an integer variable in the kernel or a module to a new value

philosophy in the modern world a new history of western philosophy volume 4 jun 2007

philosophy in the modern world a new history of western philosophy volume 4 jun 2007

Vật lý

... between them revealed the design of the creator Linnaeus and other taxonomists had divided the plant and animal kingdoms into genera and species, to which they gave Latin names All lions, for instance ... class the proletariat—cannot attain its emancipation from the sway of the exploiting and ruling class the bourgeoisie— without at the same time, and once and for all, emancipating society at large ... modern era of the importance of the great thinkers of the past A history that has already devoted many pages to Aquinas, Kant, and Hegel does not need to repeat such reminders As in writing previous...
  • 364
  • 422
  • 0
Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx

Winning in the Relationship Era™A New Model for Marketing Success By Doug Levy pptx

Quản trị kinh doanh

... population in order to move into the Sustainable Relationship quadrant To join the dialogue about these brands and to see where other leading brands appear on the Brand Sustainability Map, visit ... digital marketing in the ’90s, many marketers simply saw a new way to interrupt consumers and began searching for the best mechanisms to barge into their online experience For many innovative marketers, ... Relationship Era My agency is working to change the language marketers use and, more importantly, to evolve the mind -set associated with connecting brands and people In the Relationship Era, brands...
  • 29
  • 351
  • 0
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Cơ sở dữ liệu

... supplying the information has become less important: demand for information is becoming the most important aspect of the information chain What's more, information is playing an increasingly important ... Computer agents (in the short and medium term) will handle standard tasks and all those tasks that a computer program (i.e an agent) can faster or better than a human can Human intermediaries will handle ... certain information General, introductory information about the Internet and its services can be found in appendix two can or cannot be found in the database, and - if available - where it can...
  • 100
  • 811
  • 3
Báo cáo y học:

Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk

Y học thưởng thức

... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... to 300 s Patients received intracoronary nitroglycerin (0.1 to 0.2 mg) to achieve maximal vasodilatation before undergoing their initial and final angiograms The glycoprotein IIb/IIIa inhibitor ... for to 12 months) The PCI procedure and stent implantation were performed through a femoral or radial approach using standard methods The operators were free to use the stent approach and either...
  • 6
  • 550
  • 0
an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Tin học văn phòng

... supplying the information has become less important: demand for information is becoming the most important aspect of the information chain What's more, information is playing an increasingly important ... certain information General, introductory information about the Internet and its services can be found in appendix two can or cannot be found in the database, and - if available - where it can ... handling, and searching in, information in a domain dependent way Search engines treat information domain-independently (they not store any meta-information about the context information has been taken...
  • 100
  • 412
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Báo cáo khoa học

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Báo cáo khoa học

... essential for binding the ion and also for the rotational mechanism of the ring The c ring of I tartaricus has 11 negative charges that are equally distributed along the horizontal axis of the rotor ... mm NaCl and mm NaN3 for 24 h at 25 °C and another 24 h at 37 °C The 2D crystals were stored at °C until further analysis Atomic force microscopy An atomic force microscope (Nanoscope IIIa; DI-Veeco, ... occasionally bind to and thus compensate the negative charge on the rotor The freed positive charge on the stator attracts the next negative charge on the rotor, thus leading to rotation of the ring As...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Báo cáo khoa học

... identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and ... from strain A- 3 and strain JS45 maintain 80% activity up to 50 °C The enzyme from strain JS45 is colorless and does not have an absorbance peak at 300 nm [5] A cofactor is not required for the enzyme ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266...
  • 7
  • 613
  • 1
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc

Báo cáo khoa học

... domains in the crystal; the PYR domain has the lowest average B-factor, ˚ 23 A2 (comparable to the B-factor of bound ThDP), whereas the middle domain has the highest overall B-factor, ˚ 37 A2 ... with a rather loose packing such as ScPDC maintain the possibility of conformational changes during catalysis, and thus allow for cooperativity, whereas in ZmPDC and IPDC with tighter and more ... simulation programme for displaying reciprocal-space diffraction data J Appl Crystallogr 32, 375–376 Navaza, J (1994) AMoRe: an automated package for molecular replacement Acta Crystallogr A5 0,...
  • 10
  • 557
  • 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Báo cáo khoa học

... D-galactose, D-galactobiose and D-galactotetraose were used as standards to identify the D-galactose and D-galacto-oligosaccharides The calculated areas for D-galactose and D-galacto-oligosaccharides ... arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L-arabinose and is predominantly linear Potato arabinogalactan ... GALA initially released D-galactotriose, D-galactotetraose and D-galactopentaose from potato and onion arabinogalactan, while after prolonged incubations predominantly D-galactotriose and D-galactotetraose...
  • 9
  • 669
  • 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf

Báo cáo khoa học

... (1992) A Short Course in Bacterial Genetics A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 24 Pigac, ... S alboniger [6] They were accordingly named ataP3, ataP5, ataP4, ataP10 and ataP7 The two additional ones were named ata12 and ataPKS1 (Figs and 3) All shared a codon usage and a G+C content at ... Genetic Manipulation of Streptomyces A Laboratory Manual John Innes Foundation, Norwich, England 15 Hanahan, D (1985) Techniques for transformation of E coli In: DNA Cloning: a Practical Approach...
  • 9
  • 728
  • 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc

Báo cáo khoa học

... PCR and Southern blot analysis A 1462-bp PCR band corresponding to the extended resistance cassette was found only in the mutant strain, and a 1372-bp PCR band corresponding to the desA gene was ... was of interest to perform a transcriptional analysis of this cluster and also to characterize the promoter region (transcription start point and regulatory sequences) in order to analyze the role ... coelicolor DdesA mutant complementation A 4204-bp ScaI fragment containing the desA coding region was cloned into the pBluescript SK EcoRV site As the DdesA mutant is apramycin resistant, the kanamycin...
  • 13
  • 456
  • 0
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf

Báo cáo khoa học

... human Grb7-SH2 domain in complex with a phosphorylated peptide ligand J Biomol NMR 23, 77–78 28 Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A ... autoinhibitory mechanism Cell 86, 577–587 Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN et al (1999) The JAK-binding protein JAB inhibits ... suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation Proc Natl Acad Sci USA 96, 2071– 2076 Kamizono S, Hanada T, Yasukawa H, Minoguchi...
  • 11
  • 525
  • 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot

Báo cáo khoa học

... mRNA was analysed by agarose gel electrophoresis and autoradiography (C) Polyadenylated IFN-b mRNA AU+ was transcribed from the pBSIFNpA The poly (A) – IFN-b mRNAs, AU+pA– and AU–pA–, were transcribed ... Sendaı¨ virus for h and actinomycin D (5 lgÆmL)1) was added in the culture medium Total RNA was extracted at the indicated times and analysed by Northern blot using a 35S-labelled HA riboprobe The ... (Fig 6A) Hec-1B cells were transfected with this synthetic transcript for h, and total RNA was extracted at various times after transfection to be analysed by agarose electrophoresis and autoradiography...
  • 8
  • 361
  • 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot

Báo cáo khoa học

... Evolutionary advantage of deer Hp protein being a tetramer In addition to the superior binding affinity of Hp to hemoglobin, Hp is an anti -in ammatory molecule and a potent antioxidant [9] In humans, the ... blot using an a- chain-specific mAb prior to phenotyping Preparation of mouse mAb and human Hp Mouse mAb W1 specific to the human Hp a- chain was produced in our laboratory according to standard procedures ... Schematic drawing of the human Hp a- chain and the molecular arrangement of Hp phenotypes (A) The human Hp a1 -chain includes two avaiable )SH groups That at the C-terminus always links to a b-chain...
  • 13
  • 527
  • 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx

Báo cáo khoa học

... heated for at 120 °C prior to SDS ⁄ PAGE to disrupt the c oligomer and blotted against c1 antibodies Lane 4: ATP synthase was incubated for 10 at 80 °C, and blotted against c1 antibodies Lane 5: the ... Germany) (A) or blotted against specific antibodies (B) Lane 1: molecular mass marker Lane 2: ATP synthase preparation was denatured by incubation at 80 °C for 10 Lane 3: ATP synthase was heated ... KOH The characterization of the enzyme was performed at 30 °C by a discontinuous assay following the ATP-dependent formation of inorganic orthophosphate, according to the method of Heinonen & Lahti...
  • 8
  • 486
  • 0
Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

Báo cáo khoa học

... useful for regression analysis This dataset was randomly divided into two subsets: one containing 39 mutants, which was used as a training set, and the other containing nine mutants (ve having near ... information for obtaining descriptors that encode relevant structural information correlating with the stability changes of the Arc mutants Accordingly, we compared the accuracies of classication ... case of LDA and LMR analysis The tolerance parameter (i.e the proportion of variance that is unique to the respective variable) used was the default value for minimum acceptable tolerance, which...
  • 29
  • 406
  • 0
báo cáo hóa học:

báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx

Hóa học - Dầu khí

... oscillator strength for the ® transition In contrast to the single kink profile the shift in the intragap energies of the kink-antikink potential leads to a non-zero value for the oscillator strength ... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization ... 4 (a) show a zero value for the oscillator strength at ky = As shown in the inset of Figure 4 (a) the wavespinors for the first state a1 ,b1 and the second one a2 ,b2 at ky = are related as a1 ...
  • 10
  • 471
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Quản trị kinh doanh

... objective and can often become the ‘guardians’ of the client organization’s reputation In addition they can cover many topics with advice, both internally and externally, through trained, qualified and ... communication of an organization A consultancy usually works to one person in the organization – the ‘liaison officer’ This can sometimes lead to a sense of remoteness and a lack of any effective ... the work ethic of the organization and ignorance of it can adversely affect the consultancy’s relationships with the client Mixing and matching There are occasions when it may be more appropriate...
  • 17
  • 502
  • 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Quản trị kinh doanh

... your organization; any existing work or house style that may help the design team in their work; l any constraints in operation, eg an existing in- house design manual for detailing corporate colours, ... the day and time you want, and can use it without interruptions Internal locations These are usually easier to arrange However, remember that lighting and other technical apparatus all have to ... ones Also, you may need special clearance, permission or a fee may be payable to use certain locations, such as a garden, an interior, the front of a building, or a building site Weather watching...
  • 17
  • 433
  • 0

Xem thêm