serum creactive protein and risk of lung cancer a casecontrol study
Lung cancer - The diagnosis and treatment of lung cancer pdf
Ngày tải lên :
15/03/2014, 00:20
... cause of cancer death for men, who
account for 60% of lung cancer cases. In women, lung cancer is the second
most common cause of cancer death after breast cancer.
Survival rates for lung cancer ... research is needed into the symptoms and signs associated
with early- and late-stage lung cancer and the factors associated
with delay in presentation. For patients diagnosed with lung cancer, ... those of the USA.
Lung cancers are classified into two main categories: small-cell lung cancers
(SCLC), which account for about 20% of cases, and non-small-cell lung
cancers (NSCLC), which account...
- 41
- 470
- 0
Factors infl uencing the risk of breast cancer – established and emerging ppt
Ngày tải lên :
15/03/2014, 01:20
... breast
cancer, and as effect modifiers of the association of fat intake and risk of breast cancer. Cancer Causes Control, 8,
pp49-56.
18
Collaborative Group on Hormonal Factors in Breast Cancer ...
Collaborative Group on Hormonal Factors in Breast Cancer (1996). Breast cancer and hormonal contraceptives:
collaborative reanalysis of individual data on 53 297 women with breast cancer and ... http://www.cancerhelp.org.uk/help/default.asp?page=3285
36
Collaborative Group on Hormonal Factors in Breast Cancer (200 2a) . Alcohol, tobacco and breast cancer - collaborative
reanalysis of individual data from 53 epidemiological...
- 19
- 516
- 0
The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx
Ngày tải lên :
22/03/2014, 17:20
... Diesel Exhaust in Miners Study: A Nested Case–Control
Study of Lung Cancer and Diesel Exhaust
Debra T. Silverman, Claudine M. Samanic, Jay H. Lubin, Aaron E. Blair, Patricia A. Stewart, Roel ... considerably larger (US miners: 198 lung cancer deaths out of a
total of 278 041 person-years; German miners: 61 lung cancer
deaths out of 152 557 person-years), and the US miners had a
longer latent ... curves has been reported in
studies of other occupational exposures and cancer risk (19).
Possible biological explanations for a plateauing effect include
saturation of metabolic activation and...
- 14
- 328
- 0
Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx
Ngày tải lên :
30/03/2014, 02:20
... prostate, breast and
ovarian cancer, as demonstrated by DNA microarray
analysis and high density tissue microarrays. Its over-
expression due to gene amplification was confirmed by
array comparative ... prostate cancer [9,10]
as well as ovarian cancer [11] due to gene amplifica-
tion. The identification of TPD52 as a tumor associ-
ated antigen in breast cancer patients highlights its role
as a gene amplification ... Journal compilation ê 2008 FEBS 5705
ligands activates FAK, which interacts and activates
PI3 kinase. The PI3 kinase activates PKB ⁄ Akt by
phosphorylation and activated PKB phosphorylates
several...
- 11
- 444
- 0
Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"
Ngày tải lên :
02/11/2012, 10:09
... exposure to
loratadine was not associated with major
malformations.
However, the infrequent maternal use of
loratadine and the prevalence of hypospadias have a
major impact on sample size requirements ... drugs, maternal
epilepsy, maternal diabetes and preeclampsia.
**Adjusted for smoking, maternal age, birth order, ovulation-inducing drugs,
maternal epilepsy, maternal diabetes and preeclampsia. ... are available from
January 1, 1996 (Aarhus County) and January 1, 1998
(Ringkoebing and Viborg counties). Drugs sold over
the counter are not available in these Prescriptions
databases
Among...
- 5
- 528
- 0
Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx
Ngày tải lên :
15/02/2014, 04:20
... SLCO 4A1 22-32 TCCATCTGGCTCCTGCTGAAGAAC GCTTCTGAGGCACTCAGGCTGAAC
19 STMN1 21-25 AAAGAACTGGAGAAGCGTGCCTCAG CTGAATTTCCTCCAGGGAAAGATCC
20 TGM2 21-36 CTGGTCACTAACCAACAAGGTTG GAGCAGGAGATAAAGTCAAAGCTG
Ct: ... TGTGCATGGGTGAAGGGAGAGC
15 RAB25 21-33 TGATCGGCGAATCAGGTGTGG CAACATCACAGTGCGGGTGGAG
16 S10 0A2 22-27 GCAGCCTGGATGAGAACAGTGACC CAGCCCTGGAAGAAGTCATTGCAC
17 S100P 18-32 GTCTGAATCTAGCACCATGACG GGAAGCCTGGTAGCTCCTTC
18 ... CTGCTTCTCAGTGGCAACAAAC CCGTAGCATGCAGATGTCAAGG
6 FOSL1 18-22 TAAGGCGCGAGCGGAACAAG TCGCTGCAGCCCAGATTTCTC
7 FOXG1 23-36 GCGCCAGCAGCACTTTGAGTTAC TGGTTGTTGCCCAGCGAGTTC
8 GAPDH(GAPD) 21-22 AGTAGAGGCAGGGATGATGTTC...
- 12
- 520
- 0
Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx
Ngày tải lên :
07/03/2014, 00:20
... Dickinson).
Human lung cancer samples
Primary human lung cancers and paired noncancerous nor-
mal lung samples were obtained from 15 patients treated at
the Zhejiang Province Cancer Hospital, with ... identification
and characterization of potential factors that regulate
EGFR pathways are critical to our understanding of
lung cancer development and progression.
Emerging evidence has revealed the ... against ERK1 ⁄ 2 and phospho-ERK1 ⁄ 2 were from Chem-
icon International, Inc. (CA, USA). Antibody against Akt
was from BioVision, Inc. (CA, USA), and antibody against
phospho-Akt was from Santa...
- 8
- 536
- 0
Guidelines for the early detection and screening of breast cancer ppt
Ngày tải lên :
28/03/2014, 23:20
... health care facilities
and accessibility.
ã It is important to have accurate and updated census data, as well as data on cancer in
general and breast cancer in particular, including age-specific ... results cannot be directly linked
Natural history, etiology and risk factors 15
BRCA 1 and BRCA 2 group, and p53, account for the majority of hereditary breast
cancers. Ataxia telangiectasia (ATM ... the early detection and screening of breast cancer
It is important to have accurate and updated census data on cancer- specific mortality
and incidence. There are no significant data to indicate...
- 57
- 489
- 0
Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx
Ngày tải lên :
29/03/2014, 01:20
...
Learning About Breast Cancer
Breast cancer is a malignant (muh-LIG-nent) tumor that starts with
cells in the breast. Malignant means that the cells are cancerous and
may spread to other ... breast cancer. A woman’s risk of breast
cancer depends on her age and other risk factors. Most women who
get breast cancer have no risk factors other than growing older. And
many women who have risk ... case. Maybe the medicines reduce the
kinds of breast cancers that are easiest to treat.
Breast Cancer Risk Factors
Age
Getting older raises the risk of breast cancer.
Family history
Having a...
- 16
- 400
- 0
Updates in the Understanding and Management of Thyroid Cancer Edited by Thomas J. Fahey doc
Ngày tải lên :
30/03/2014, 22:20
... breast cancer case, 1 prostate cancer
case, 1 case of sigmoid colon cancer, 1 case of liver cancer, 1 case of glioblastoma multiform, 1
case of pancreatic cancer , 1 case of multiple myeloma) ... Helix pomatia agglutinin (HPA) which
detects GalNAc1-4 Gal, is a part of a panel of markers for histological characterization of
gastric cancer specimens. HPA as well as Ulex europaeus agglutinin ... levels was increased in 28 of 40 papillary carcinomas and in 6 of 7 anaplastic
carcinomas compared with normal or hyperplastic thyroid. Immunohistochemical analysis
of normal thyroid and papillary...
- 314
- 575
- 0
costs and effectiveness of prostate cancer screening in elderly men potx
Ngày tải lên :
01/04/2014, 13:20
... class="bi x0 y0 w0 h8" alt=""
- 138
- 211
- 0
Báo cáo hóa học: " Ezrin promotes invasion and metastasis of pancreatic cancer cells" ppt
Ngày tải lên :
18/06/2014, 16:20
... K, Matsuoka Y, Takasuka N, Takeshita F, Naito A, Iigo M,
Alexander DB, Moore MA, Saito I, Ochiya T, Tsuda H: Ductal origin of
pancreatic adenocarcinomas induced by conditional activation of a
human ... 2010
References
1. Sato N, Funayama N, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S: A gene
family consisting of ezrin, radixin and moesin. Its specific localization at
actin filament/plasma membrane association ... metastasis of
pancreatic cancer cells
Yunxiao Meng, Zhaohui Lu, Shuangni Yu, Qiang Zhang, Yihui Ma, Jie Chen
*
Abstract
Background: Pancreatic cancer has a high mortality rate because it is usually...
- 14
- 525
- 0