sensitivity analysis of a fish population model

Báo cáo sinh học: "Molecular genetic analysis of a cattle population to reconstitute the extinct Algarvia breed" pptx

Báo cáo sinh học: "Molecular genetic analysis of a cattle population to reconstitute the extinct Algarvia breed" pptx

Ngày tải lên : 14/08/2014, 13:21
... Garvonesa, two Mertolenga and one Preta individuals Two Algarvia animals (AG40 and AG43) and one Garvonesa shared a T 1a haplotype Interestingly, a T 1a haplotype found in one Algarvia (AG16) and three ... group of 33 Algarvia animals and the Garvonesa breed through their sharing of haplotypes Common Iberian matrilines (European T3 and African T 1a) were found in the Algarvia population, as well as a ... Thirty-two Algarvia animals formed two closely related subgroups each containing a few Alentejana animals Five Algarvia individuals clustered with Garvonesa (AG24, AG27, AG33, AG34 and AG35), four...
  • 11
  • 356
  • 0
báo cáo hóa học:" Biomechanical analysis of a synthetic femoral spiral fracture model: Do end caps improve retrograde flexible intramedullary nail fixation?" ppt

báo cáo hóa học:" Biomechanical analysis of a synthetic femoral spiral fracture model: Do end caps improve retrograde flexible intramedullary nail fixation?" ppt

Ngày tải lên : 20/06/2014, 07:20
... that simulated both cortical and cancellous bone The femoral model measured 45 cm in length, with a central canal diameter of 10 mm A standard spiral fracture was created on Sawbones ® with a ... Alman BA: Complications of elastic stable intramedullary nail fixation of pediatric femoral fractures, and how to avoid them J Pediatr Orthop 2004, 24:363-369 Kaiser et al Journal of Orthopaedic ... M, Cappello A, Toni A: Mechanical validation of whole bone composite femur models J Biomech 1996, 29:525-535 39 Fricka KB, Mahar AT, Lee SS, Newton PO: Biomechanical analysis of antegrade and...
  • 7
  • 399
  • 0
Báo cáo hóa học: " Bifurcation analysis of a diffusive model of pioneer and climax species interaction" pot

Báo cáo hóa học: " Bifurcation analysis of a diffusive model of pioneer and climax species interaction" pot

Ngày tải lên : 20/06/2014, 22:20
... this article This research was supported by the National Natural Science Foundation of China (No 11031002) Authors’ contributions JL carried out the theoretical analysis and simulation, and drafted ... bifurcation occurring are also searched And the stability and direction of the bifurcating periodic solutions at l1 are studied In Section 3, some conclusions are stated Hopf bifurcation analysis ... and drafted the manuscript JW conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript Competing...
  • 11
  • 280
  • 0
báo cáo hóa học:" Dynamical analysis of a biological resource management model with impulsive releasing and harvesting" pdf

báo cáo hóa học:" Dynamical analysis of a biological resource management model with impulsive releasing and harvesting" pdf

Ngày tải lên : 21/06/2014, 17:20
... Dynamical analysis of a biological resource management model with impulsive releasing and harvesting Jianjun Jiao∗1 , Lansun Chen2 and Shaohong Cai1 School of Mathematics and Statistics, ... per-capita rate of predation of the predator, d > is the death rate of predator, c > denotes the product of the per-capita rate of predation and the rate of conversing prey into predator If rc < ad ... investigated a predator–prey model with impulsive releasing prey population and impulsive harvesting predator population and prey population at different fixed moment We analyze that the predator-extinction...
  • 31
  • 284
  • 0
Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Báo cáo hóa học: " Research Article Modelling and Comparative Performance Analysis of a Time-Reversed UWB System" doc

Ngày tải lên : 22/06/2014, 19:20
... Also, a quasistationary channel is assumed, such that it remains time-invariant for the transmission of a full UWB packet Calculations are based upon the CM1 channel scenario of the 802.15. 3a ... it was determined that an MUI variance within 5% of the final value could be obtained after approximately 100 iterations The Nl , Nw , and Nov path alignment parameter variations for both ISI and ... is defined as a statistically independent zero mean Gaussian random variable The ISI and MUI terms may be brought under the standard Gaussian approximation provided that the number of paths within...
  • 11
  • 333
  • 0
Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

Báo cáo sinh học: "Population analysis of a purebred Hereford and a multibreed synthetic beef cattle herd" docx

Ngày tải lên : 09/08/2014, 18:21
... (probability at birth of an animal surviving to a particular age, Lx); survival rate (probability at a particular age of surviving to the next age, Px); mortality rate (probability at a particular ... (probability of a cow of a particular age producing a live female calf, Mx); and reproductive value (relative contribution of an animal of a particular age to future generations, Vx) The overall life table ... et al, 1980), organize breeding schemes (Wiener, 1961; Lauvergne et al, 1973; Martin, 1975; Basu and Ghai, 1980) and as a check on management practices (Nadkarni et al, 1983) A similar analysis...
  • 14
  • 314
  • 0
Báo cáo sinh học: " Power and parameter estimation of complex segregation analysis under a finite locus model" pot

Báo cáo sinh học: " Power and parameter estimation of complex segregation analysis under a finite locus model" pot

Ngày tải lên : 09/08/2014, 18:22
... test statistic was calculated by comparing a general model to a model with equal means (fJ fJAa /= AA = t aa)Because SALP and PAP use different parameterization of effects, parameters were converted ... MacLean (1974) Complex segregation analysis combines three factors into a mixed model for analysis of phenotypes for a quantitative trait: a gene which explains a detectable part of genetic variance ... means ( and Aaa gene frequency of the PAA ), dominant allele (p), and polygenic (ufl) and environmental (ud) variances Instead of polygenic and environmental variances, PAP estimates heritability...
  • 14
  • 404
  • 0
Báo cáo y học: " Theoretical size distribution of fossil taxa: analysis of a null model" ppsx

Báo cáo y học: " Theoretical size distribution of fossil taxa: analysis of a null model" ppsx

Ngày tải lên : 13/08/2014, 16:21
... Patzkowsky ME: A hierarchical branching model of evolutionary radiations Paleobiology 1995, 21:440-460 Przeworski M, Wall JD: An evaluation of a hierarchical branching process as a model for species ... by Raup[2] In particular we obtain results for size distributions of taxa and probabilities of monotypic taxa In this paper we confine attention to obtaining analytic results and defer actual ... sampling variation due to a finite number of runs (noise) and signal It is the purpose of this paper to conduct a more thorough analysis of the birth-and-death model than that previosly carried...
  • 12
  • 213
  • 0
Báo cáo y học: " Construction and analysis of a modular model of caspase activation in apoptosis" pot

Báo cáo y học: " Construction and analysis of a modular model of caspase activation in apoptosis" pot

Ngày tải lên : 13/08/2014, 16:21
... Casp8* Casp3 Casp3* XIAP Casp3*-XIAP BAR Casp8*-BAR Bid tBid tBid-Bax2 Cytc Cytc* Smac Smac* Smac*-XIAP Apop Casp9 Casp9* Casp9*-XIAP DISC procaspase-8 caspase-8 procaspase-3 caspase-3 XIAP Casp3*-XIAP ... cell death for either pathway is executed through a cascade activation of effector caspases (e.g., caspase-3) by initiator caspases (e.g., caspase-8 and -9) and the amplification of death signals ... 26 aCasp8 aCasp3 aXIAP aBAR aBid aCytc aSmac aCasp9 Degradation rate 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 μDISC μCasp8 μCasp8* μCasp3 μCasp3* μXIAP μCasp3*-XIAP μBAR...
  • 15
  • 429
  • 0
Modelling and analysis of a new integrated radiofrequency ablation and division device

Modelling and analysis of a new integrated radiofrequency ablation and division device

Ngày tải lên : 16/10/2015, 15:36
... (cryoablation), and extreme heatbased (radiofrequency ablation, microwave ablation and laser ablation) ablations These treatments can be performed in laparoscopic, percutaneous, and open surgery Among ... experimental data unavailable in previous approaches and this advantage can lead to the development of an effective VR laparoscopic surgery trainer Figure 2.5: Interactive simulation of a liver model ... viscoelastic substrate and it is based on suitability of the implementation that appropriate results can be acquired In studying the mechanical model of the human vocal fold, Flanagan and Landgraf...
  • 112
  • 294
  • 0
Modeling And Analysis Of A Cracked Composite Cantilever Beam Vibrating In Coupled Bending And Torsion

Modeling And Analysis Of A Cracked Composite Cantilever Beam Vibrating In Coupled Bending And Torsion

Ngày tải lên : 25/11/2016, 21:53
... ¼ A1 A2 A3 A4 A5 A6 A7 A8 A9 A1 0 A1 1 A1 2 Š and ½LŠ is the 12  12 characteristic matrix, a function of frequency Solving for det½LŠ ¼ yields the natural frequencies Substituting each natural ... Natural frequency change as a function of crack location, its depth and material properties (y and V) 5.3.1 Natural frequency change as a function of crack ratio and fiber angle Assume that the ... Engineering Fracture Mechanics 70 (2003) 105–123 [11] J.B Kosmatka, J Panza, Aeroelastic stability of the GA-ASI Predator aircraft, AIAA’s First Technical Conference and Workshop on Unmanned Aerospace...
  • 27
  • 465
  • 0
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal

Ngày tải lên : 05/09/2013, 14:59
... economical and financial assessing of a wind farm as a manner of validating the indicators of attractiveness and risk of energy projects and analysis of production costs sensitivity analysis was done ... analysis (optional): In this final step, we analyze uncertainty of financial estimates several parameters that can affect the financial viability of the project Can be performed sensitivity analysis ... 5,766,604 Table 15 Comparison in percentage values of calculated parameters in the scenarios Item ICC AARaverage Operating costaverage O&Maverage Debtaverage Taxaverage LRC Dv Source: own elaboration...
  • 14
  • 416
  • 1
Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Computational fluid dynamics analysis of a twisted airfoil shaped two-bladed H-Darrieus rotor made from fibreglass reinforced plastic (FRP)

Ngày tải lên : 05/09/2013, 15:28
... that, for H/D ratio 1.92, the maximum Cp obtained is 0.042 at a TSR of 0.747 and maximum Ct obtained is 0.055 at a TSR of 0.747 and the standard deviations of Cp and Ct are 0.38% and 0.53% (a) ... TSR of 2.214, and the maximum Ct obtained is 0.124 at a TSR of 1.962 And the standard deviation of computational Cp from experimental Cp is 0.81% and that of computational Ct from experimental ... 23 (a) Variation of Ct with TSR, and (b) deviation of computational Ct from experimental Cp for H/D ratio 2.10 (a) (b) Figure 24 (a) Variation of Cp with TSR, and (b) deviation of computational...
  • 16
  • 364
  • 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Ngày tải lên : 05/09/2013, 16:30
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... mathematical optimization Table Results obtained with the genetic algorithm Decision variable Case Case EIS EIS Alternative Alternative Mathematical EIS optimization Alternative EIS Alternative Mathematical...
  • 14
  • 593
  • 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model

Ngày tải lên : 06/09/2013, 05:48
... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower ... populated and largest metropolitan city of Pakistan, Karachi The city of Karachi comprises a diverse The sample size was drawn from three towns of Karachi, which included Landhi, Korangi, and Orangi...
  • 23
  • 552
  • 0
Reliability analysis of a power system based on the multi state system theory

Reliability analysis of a power system based on the multi state system theory

Ngày tải lên : 03/01/2014, 19:38
... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all ... performance of each state is defined as the minimum capacity of each interval, that is: g1 = 5200 , g = 5550 , g3 = 5700 , g = 5850 , V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of ... Function in Reliability Analysis and Optimization, London: Springer, 2005 A Lisnianski, and G Levitin, Multi-state System Reliability: Assessment, Optimization and Applications Singapore: World Scientific,...
  • 4
  • 407
  • 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Ngày tải lên : 22/02/2014, 04:20
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... standards (Amersham-Pharmacia Biotech or BioÁRad) DNA fragments of appropriate length were ligated into the T /A vector, pCRII (Invitrogen, San Diego, CA, USA), using T4 DNA ligase overnight at...
  • 10
  • 495
  • 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Ngày tải lên : 06/03/2014, 22:21
... demonstrate large conformational changes in the eukaryotic ribosomal translocase Nat Struct Biol 10, 379–385 Al Karadaghi S, Aevarsson A, Garber M, Zheltonosova J & Liljas A (1996) The structure of ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... Karplus PA (1997) Improved R-factors for diffraction data analysis in macromolecular crystallography Nat Struct Biol 4, 269–275 Richter Dahlfors AA & Kurland CG (1990) Novel mutants of elongation...
  • 15
  • 474
  • 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... secondary antibody was quantified by adding the substrate o-phenylenediamine dihydrochloride and measuring the resulting absorbance at 490 nm in a microplate reader SPR analysis SPR analysis of NTD ... aureus, one of the most important Gram-positive pathogens of humans and animals, is a highly versatile bacterium capable of causing a wide spectrum of diseases, ranging from superficial skin infections...
  • 16
  • 560
  • 0