selecting all elements lacking a particular attribute with a particular value

Báo cáo toán học: "Products of all elements in a loop and a framework for non-associative analogues of the Hall-Paige conjecture" potx

Báo cáo toán học: "Products of all elements in a loop and a framework for non-associative analogues of the Hall-Paige conjecture" potx

Ngày tải lên : 07/08/2014, 21:21
... appears as a row, y as a column, and z as an entry A k-plex is a subset of L in which each symbol appears as a row, column, and entry precisely k times A 1-plex is called a transversal and a k-plex ... ) Since A (xA) = ρ(x )A = xA, it is constant by (iii) Thus A (A) = A and in particular ρ(1) = a1 (a2 (· · · (ak ) · · · ) ∈ A Lemma 4.1 is stated somewhat more generally then we actually need ... then a1 (a2 (· · · (ak ) · · · ) ∈ A( Q) Proof Set A := A( Q) (i) Let ρ = La1 · · · Lak Then A (qA) = a1 (a2 · · · (ak q) · · · )A Since Q /A is a group, we may reassociate to get A (qA) = a1 (a2 ...
  • 15
  • 298
  • 0
Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx

Báo cáo toán học: "Note on generating all subsets of a finite set with disjoint union" potx

Ngày tải lên : 07/08/2014, 21:21
... Nikiforov (a slight weakening of Theorem in [4]): Theorem Let a ≥ 2, ca log n ≥ Then any graph on n vertices with at least cna Ka ’s contains a Ka (t) with t = ⌊ca log n⌋ We see that provided ... family G ⊂ P[n] a k-base of P[n] if every x ⊂ [n] can be expressed as a union of at most k sets in G; they conjectured that for any k ≤ n, any k-base of P[n] is at least as large as Fn,k ... complete subgraphs contained in certain graphs, Publ o Math Inst Hung Acad Sci., Ser A (1962), pp 459-464 [4] Nikiforov, V., Graphs with many r -cliques have large complete r -partite subgraphs, Bulletin...
  • 6
  • 215
  • 0
Tài liệu Elements of a PR Plan pptx

Tài liệu Elements of a PR Plan pptx

Ngày tải lên : 23/12/2013, 00:15
... build and maintain your database to achieve maximum effectiveness Annual Reports Annual reports are usually associated with public companies They can, however, be used by any organization with enough ... be targeted based on parameters you set Have a story that deals with a labor issue in California? Target the workplace reporters/editors in California publications Elements of a PR Program Announcements ... becoming a major publicity tool as people take advantage of the Web’s multimedia capabilities Webcasts can be live events or archived and available on demand They are a cost-effective, instantaneous...
  • 15
  • 432
  • 1
Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

Báo cáo khoa học: Organizational constraints on Ste12 cis-elements for a pheromone response in Saccharomyces cerevisiae docx

Ngày tải lên : 06/03/2014, 22:21
... wild-type Ste12 to a PRE consensus (ATGAAACA) in vitro FUS1 PREa Sequence RCSb II IV ATGAAACA tTGAAACA AaGAAACA ATaAAACA ATcAAACA ATtAAACA ATGcAACA ATGgAACA ATGAgACA ATGAAgCA ATGAAAgA ATGAAACg 1.00 0.27c ... that PREs are arranged in a variety of configurations Most promoters have PREs in a directlyrepeated orientation, although there are many instances of PREs arranged in a tail-to-tail configuration ... indicate that there must be structural constraints on Ste12 that allow binding to closely-spaced PREs in several different configurations Additionally, the fact that head-to-head and tail-to-tail...
  • 14
  • 428
  • 0
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Ngày tải lên : 22/03/2014, 12:20
... (CDC), Atlanta, USA Paula Morgan Centers for Disease Control and Prevention (CDC), Atlanta, USA Naomi Nhiwatiwa World Health Organization (WHO)/Regional Office for Africa, Harare, Zimbabwe Shanti ... the availability of trained staff, and the capacity to plan and evaluate efforts Knowing this information allows the team to draw on available personnel and financial resources and set reachable ... contraception, but this varied from about 30% in Mali to more than 90% in Botswana (Senderowitz, 1994) Data from various countries in Latin America, Asia, and sub-Saharan Africa indicate that in...
  • 90
  • 469
  • 0
all about particles a handbook of japanese function words

all about particles a handbook of japanese function words

Ngày tải lên : 27/03/2014, 12:19
... Kwd -a e ew 0k e g,n a a uaa aaasn dna a t k t ka at eehnd a a a n h eeigbt e ant hr tlpoe K w d i te vnn, h ws' tee u 川田さんへの電話があったのは何時でしたか。 K w d ・ a e o ew g aa o a a i e i k a a as n dna a t ... Wtsi , mkn a i o a aaa aokdmn nr nn aah w ia y r gy bnn nd,uaoo aa a a n d m s ie e o u du k s 1i a y id f ut a d r n rne, pe, nns l e n kn o 企 i m n a i oagsa lsb aa k : p a Idctsa e a v sgeto:“r ... Oaasn ain g hkms kd -a w pao a ieau O a a a pa te in k d cn ly h pao Idcts te ojc o vrs a d a e i s o ncsiy niae h bet f eb n d c v f eest j te 山田さんは中国語がわかります。 Ymd -a w Cuou o a aaiau aaasn a...
  • 73
  • 609
  • 4
báo cáo hóa học:" Research Article Existence and Multiplicity of Positive Solutions of a Boundary-Value Problem for Sixth-Order ODE with Three Parameters" pdf

báo cáo hóa học:" Research Article Existence and Multiplicity of Positive Solutions of a Boundary-Value Problem for Sixth-Order ODE with Three Parameters" pdf

Ngày tải lên : 21/06/2014, 11:20
... 2.1 Let A b2 − 3ac, B bc − 9ad, C c2 − 3bd, Δ B2 − 4AC, 2.2 one has the following: Equation 2.1 has a triple root if A B 0, Equation 2.1 has a real root and two mutually conjugate imaginary roots ... fourth-order boundary value problems with two parameters,” Journal of Mathematical Analysis and Applications, vol 281, no 2, pp 477–484, 2003 S Fan, “The new root formula and criterion of cubic equation,” ... symbol of the linear differential Au Bu Cu operator Lu u At the same time, in investigating such spatial patterns, some other high-order parabolic differential equations appear, such as the extended...
  • 13
  • 397
  • 0
Family of Uniform Strain Tetrahedral Elements and a Method for Connecting Dissimilar Finite Element Meshes ppt

Family of Uniform Strain Tetrahedral Elements and a Method for Connecting Dissimilar Finite Element Meshes ppt

Ngày tải lên : 27/06/2014, 14:20
... aol 00 aol 00 o all 00 —asl O o o asl 00 (@’w’@ )-’@’w = 00 azn asn o aln o azl all a3 n a2 ,n o 00 ah aln aoz o —azz 0 –asn o o aoz o 00 aol O —alz 00 —azl —aBz O 0 o aos —aln o —azn 00 ... mid-face nodes are centered The alternative formulation shares all the computational advantages of the least squares approach and can use the same method of hourglass control Moreover, satisfaction ... (49) A) (I – 2a + 5Q2)V and for plane stress, Al = A2 = 4G(1 – 2a+ 5a2 )V (50) :(1 — (51) - 2a+ 5c12)v Notice that the eigenvalues are a quadratic function of a The smallest eigenvalues are obtained...
  • 141
  • 153
  • 0
Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf

Báo cáo lâm nghiệp: "Utilization of a dynamometric pendulum to estimate cutting forces involved during routing. Comparison with actual calculated values" pdf

Ngày tải lên : 08/08/2014, 00:22
... the accuracy of measurements was estimated Results showed a very high repetitivity with a variation coefficient of 0.1% These gaps are really non significative and can be explained by manual sample ... mechanical stresses depend on chip formation [11, 15, 16, 19], it appears clearly that, in routing, notions of crack propagations (with fracture toughness parameter), and cellular-wall mechanical ... decreased to 1mm in order to obtain appropriate chip formation Each value of cutting forces reported, is a mean of ten measurements obtained on each species This pendulum was adapted for easy adaptability:...
  • 7
  • 323
  • 0
Báo cáo khoa học: "Fluxes of dissolved mineral elements through a forest ecosystem submitted to extremely" pps

Báo cáo khoa học: "Fluxes of dissolved mineral elements through a forest ecosystem submitted to extremely" pps

Ngày tải lên : 08/08/2014, 23:22
... calculated by multiplying the volume weighted mean annual values of concentration by either the measured annual amount of throughfall, or a calculated amount of drainage water Taking into account ... Exchangeable base cations and acidity were determined after M KCI extraction CEC was calculated as the sum of the exchangeable base cations and acidity Total sulphur was determined by X-ray fluorescence ... basic cations as Ca, but also of Fe and Al, which are more typical of acid soil solutions than throughfall Assuming that most of these elements come from wind-blown ash, one can calculate that al-...
  • 11
  • 130
  • 0
Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps

Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps

Ngày tải lên : 11/08/2014, 08:20
... Statins have also been shown to have a role in the treatment of atrial arrhythmias Inflammatory changes have been shown in atrial biopsy specimens of patients with lone atrial fibrillation (AF) ... recurrent myocardial infarction Using data from the Prospective Randomised Amlodipine Survival Evaluation (PRAISE) trial, association of statin therapy with total mortality among 1,153 patients with severe ... necrosis factor-alpha, and brain natriuretic factor in patients with idiopathic dilated CMP[52] The effect on patient outcomes was however not evaluated Again as in case of heart failure, although...
  • 12
  • 346
  • 0
Báo cáo sinh học: " Enhanced individual selection for selecting fast growing fish: the “PROSPER” method, with application on brown trout (Salmo trutta fario)" docx

Báo cáo sinh học: " Enhanced individual selection for selecting fast growing fish: the “PROSPER” method, with application on brown trout (Salmo trutta fario)" docx

Ngày tải lên : 14/08/2014, 13:22
... it and to propagate it Additional information may be drawn from the variability at neutral markers, which may give indications on past bottlenecks, likely to have reduced its initial genetic variability ... equal and we can assume that there are no more maternal effects within the group (equivalent to one dam per group with respect to maternal effects, and d dams per group with respect to additive variance), ... (Large, Medium) have a low phenotypic variance but are assumed to have a high genetic variance Within each cluster, the “Medium” group and the “Large” group are reared under the same density and...
  • 19
  • 270
  • 0
Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx

Báo cáo y học: "Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach" ppsx

Ngày tải lên : 14/08/2014, 14:21
... TTCAACATGAAACAtcagtactatactgtcaactcctgtaggct PAR ctcctg-agtaagacagcctagtacAAATGAAAA gAACCACActgctttacaataaaacaacggtacc-cactaagaattcaggcaggct MIK ctcatg-tgtacgacggccttatacaaaCAAGAAGAGCCATGCAgctttacaa ... * MATalpha2p AGTACATGATGAAACAcatATGAAGAAaa-aagctttcctacaTATTCAAGA tttttttctgtgggtggaatacTATTTAA-ggagtg ATTACATGGTGAAACAtgt AATACATGATGAAACAcatATGAAAAAaa-aagcttttctacatattcgaggg-tttttttctgTTGGTGGa-tac ... gcaccgttaag-aacca -tatCCAAGAATcaaaa gcaccattaag-aacaactgtatCCAAGAAGcaaaagtatcattagttaaaaagtgtacttaaggagcaaaag STE2 (b) Upc2p deposited research ctattagtatcttat-ttgacTTCAAAGcaatacgatacc-ttttcTTTTCACctgctctggctataattataattggttacttaaaaat...
  • 27
  • 276
  • 0
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx

Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx

Ngày tải lên : 14/08/2014, 16:21
... T-AGCCGTGTGCTATGTGAAAGATGGCAG-GCTTAAAAAAT human TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT ... TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGGTTCAGC-AGACACTCTGGGTGATCTTTATTGAGTGAT ... CATGATAAAGATAGCAC-CTATATTTGAT TTAGCTGTGT CATGATAAAGATAGCAC-CTATATTTGAT tetr danio TTAATCTGGTGCTTTGTGCAGTAAAACAG-TTCTACAGAAT refereed research fugu deposited research 5‘ SCE Rat Dog reports (b) Human reviews...
  • 19
  • 510
  • 0
A fast method to segment images with additive intensity value

A fast method to segment images with additive intensity value

Ngày tải lên : 16/09/2015, 12:35
... identification of the true objects O1 and O2 from a given image u is called an additive segmentation problem A segmentation of an image u is a pair of objects {E1 , E2 } such that E1 , E2 ⊆ Ω and ... λm1 and λm2 are Lagrange multipliers and rp1 , rp2 , rn1 , rn2 , rm1 and rm2 are positive penalty parameters It is known that one of the saddle points of the augmented Lagrangian functional gives ... computationally expensive as the gradient flow is a fourth-order partial differential equation However, when we allow some of the terms of EulerLagrange equations to be lagged, the problem becomes a...
  • 79
  • 162
  • 0
Living with Variability - Declaring Value-Type Variables

Living with Variability - Declaring Value-Type Variables

Ngày tải lên : 04/10/2013, 21:20
... example: char c = a ; You can store any single character from the Roman, Hebrew, Arab, Cyrillic, and most other alphabets You can also store Japanese katakana and hiragana characters and many Japanese ... string Char variable type The char variable is a box capable of holding a single character Character constants appear as a character surrounded by a pair of single quotation marks, as in this example: ... it with a value of The term initialize means to assign an initial value To initialize a variable is to assign it a value for the first time You don’t know for sure what the value of a variable...
  • 20
  • 274
  • 0
Tài liệu Retrieving a Single Value from a Query pdf

Tài liệu Retrieving a Single Value from a Query pdf

Ngày tải lên : 14/12/2013, 18:16
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
  • 2
  • 312
  • 0