schematics of primers designed for chip assay ten putative sbes were identified within this region by a bioinformatics tool promo in the region from 191 to 840 of tg2 promoter 4 pairs of primers each encompassing 200bp domains were desi

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot

Ngày tải lên : 08/03/2014, 02:21
... obtained in an analogous manner (data not shown) and for all glycoforms the hexoses were found to be members of a linear chain attached to HepI (Table 3) For the major Hep4-glycoform with the ... data, the residues with anomeric resonances at d 4. 46, 4. 94, 4. 52, 4. 91 and 4. 62 were attributed to the t-Gal (GalI and GalII), 4- Gal (GalI*), 3-Gal (GalII*) and t-GalNAc (GalNAc) identified by linkage ... basis of low J3 ,4 and J4,5 values (
  • 13
  • 433
  • 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Ngày tải lên : 19/02/2014, 16:20
... any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4- amino-3-hydroxybenzoate ... was prepared by incubating catechol with resting cells of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4- amino-3hydroxybenzoic ... while the enzyme from P pseudoalcaligenes strain JS45 has a molecular mass of 100 kDa and consists of six identical subunits The enzymes from strain A- 3 and strain JS45 maintain 80% activity up to...
  • 7
  • 613
  • 1
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Ngày tải lên : 31/03/2014, 08:20
... F180AMY2, K182AMY2, W206AMY2, S208AMY2, Y211AMY2, H288AMY2, Q294AMY2, M296AMY2 and Q35TAA, H122TAA, R204TAA, K209TAA, H210TAA, G234TAA, D 340 TAA, R 344 TAA) are in purple Amylose DP17 amylose DP17 of ... D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H122TAA; M52AMY2 (M53AMY1) and W83TAA are at subsite )2; T94AMY2 (C95AMY1) at subsite-5 ... above) are colored in yellow M52AMY2 (M53AMY1) and W83TAA are in red (indicated by arrow) Y51AMY2 and Y82TAA are in orange Other binding residues (W9AMY2, H92AMY2, T94AMY2, A9 5AMY2, Y130AMY2, A1 45 AMY2,...
  • 14
  • 557
  • 0
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"

Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"

Ngày tải lên : 26/10/2012, 09:39
... 40 6a 27 Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama ... cellular RNA; median in our laboratory, n=120) during the imatinib treatment, the transcripts gradually increased to more than 4, 000 copies spontaneously thereafter Imatinib was increased to a dose ... 2000;95:2198-2203 Oka Y, Tsuboi A, Kawakami M, Elisseeva OA, Nakajima H, Udaka K, Kawase I, Oji Y, Sugiyama H: Development of WT1 peptide cancer vaccine against hematopoietic malignancies and solid cancers...
  • 10
  • 739
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Ngày tải lên : 18/02/2014, 08:20
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... of specific chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 ... of macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading to the maturation of the cytochrome bc1 complex in the inner mitochondrial...
  • 15
  • 639
  • 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx

Ngày tải lên : 21/02/2014, 15:20
... bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative bacteria with increasing angle subtended by the cationic ... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins ... isolation and characterization of amphipathic a- helical peptides from the venom of Opistophtalmus carinatus, a scorpion living in southern Africa, and we have made a comparative analysis of the...
  • 12
  • 598
  • 0
Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt

Ngày tải lên : 22/02/2014, 07:20
... After the last wash, the starch pellet was stored at °C awaiting further analysis Separation of starch polysaccharides by gel permeation chromatography In vitro assay of GBSSI activity This assay ... displays a typical red iodine stain Stains of others strains result from various levels of phenotypic complementation indicating, in most cases (except for strain N), a partial restoration of amylose ... strains obtained from a cross involving CS9 and IJ2 parental strains ability of GBSSI to extend amylopectin outer chains Again this coincides with a decrease in crystallinity This situation closely...
  • 11
  • 556
  • 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc

Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc

Ngày tải lên : 05/03/2014, 23:20
... construction of the domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r in the ... central domain of the map g as A1 and consider the first return map onto A1 This map is again a real holomorphic box mapping and we can again consider the first return map onto the domain A2 (which ... of this point By compactness £ arguments we obtain that for small λ the map φλ is injective According to the λ-lemma we can extend the map φλ to the domain In other words, there is a family of...
  • 44
  • 412
  • 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot

Considering the Creation of a Domestic Intelligence Agency in the United States pot

Ngày tải lên : 15/03/2014, 21:20
... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... security agencies tasked with garnering information on the activities of Imperial Japan in the Asia-Pacific This legislation specifically designates ASIO as Australia’s principal national agency ... counterparts in other Western democracies such as France, Britain, Germany, Italy, and Canada, ASIO derives much of this information from human sources A certain amount of data emanates from well-placed...
  • 218
  • 375
  • 0
BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx

BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx

Ngày tải lên : 18/03/2014, 02:20
... faster rate An example of this is described by author Nancy Ohanian in Spain: "about 1150, papermakers in Xatina, Spain, began to use water power to beat the rags They extended the axle of the ... enough to adapt bamboo into their manufacturing process Booshoot needs to control the raw material into the chipping stage of the supply chain in order to maximize profitability and make this endeavor ... when the art of papermaking became known to Europeans The raw material of papyrus was a reed.,, 34 The reeds were cut thin and laid side by side and gummed together to create a sheet Other material...
  • 84
  • 472
  • 0
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf

Ngày tải lên : 23/03/2014, 06:20
... (TTTGTTTAACTTTAAGAAGG AGATATACATATGAATCG) and AmyRev-NcoI (aaaac catGGGCTTTGTTAGCAGCCGGAT) The amplified fragment was ligated into the NdeI and NcoI sites of pSY1 [30] A derivative (pSY-AmyH_KK) was also made ... to twin lysines (AmyHKK) The primers used for Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctttTGGCAAGACTTTCCTTAGC) ... pET-AmyH for use in in vitro transcription ⁄ translation (see below), amyH was amplified using chromosomal DNA of H hispanica as template, and primers AmyH-T 7a (atatcatATGAATCGACCCCGAATTACC GGCAG)...
  • 9
  • 414
  • 0
Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Báo cáo khoa học: A steady-state competition model describes the modulating effects of thrombomodulin on thrombin inhibition by plasminogen activator inhibitor-1 in the absence and presence of vitronectin ppt

Ngày tải lên : 23/03/2014, 17:21
... macrophages in atherosclerotic lesions of the human and rabbit aorta [ 14] Also, due to the colocalization of thrombin, PAI-1 and VN in the vessel wall, increasing attention is being paid to the mitogenic ... thrombin-VR1tPA is in agreement with the significant contribution of this part of the VR1 loop to the binding of TM by thrombin Binding of the carboxy-terminal part of the reactive center loop of PAI-1 in the ... Probably the main physiologic consequence of this interaction is an inactivation of the PAI-1 pool in the vascular wall by thrombin, making it no longer available for interaction with u-PA and...
  • 10
  • 483
  • 0
Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc

Ngày tải lên : 23/03/2014, 20:22
... phenylthiohydantoin amino-acid standards Tricine/SDS/PAGE The molecular mass of the sample was estimated by Tricine/ SDS/PAGE using a 16.5% separating gel, 10% spacer gel and 4% stacking gel in the presence ... killing of the bacteria [28] All assays were performed in duplicate Fish and crustacean pathogens, Lactococcus garvieae YT-3, Streptococcus iniae F-8502, Aeromonas hydrophila ET -4, Edwardsiella ... bacterial membrane, adopting an amphipathic a- helical conformation that allows them to insert the hydrophobic face into the lipid bilayers and form a pore [1,8,22] The amphipathic a- helical structure...
  • 12
  • 482
  • 0
Alice’s Adventures in WonderlandBy Lewis Caroll (1865)Download free eBooks of classic literature, books and novels at Planet eBook. Subscribe to our free eBooks blog and email newsletter..All in the Golden AfternoonAll in the golden afternoon Full ppt

Alice’s Adventures in WonderlandBy Lewis Caroll (1865)Download free eBooks of classic literature, books and novels at Planet eBook. Subscribe to our free eBooks blog and email newsletter..All in the Golden AfternoonAll in the golden afternoon Full ppt

Ngày tải lên : 24/03/2014, 00:20
... slipped, and in another moment, splash! she was up to her chin in salt water Her first idea was that she had somehow fallen into the sea, ‘and in that case I can go back by railway,’ she said to herself ... D,’ she added in a whisper, half afraid that it would be offended again ‘Mine is a long and a sad tale!’ said the Mouse, turning to Alice, and sighing ‘It IS a long tail, certainly,’ said Alice, ... wonder what they will next! If they had any sense, they’d take the roof off.’ After a minute or two, they began moving about again, and Alice heard the Rabbit say, A barrowful will do, to begin with.’...
  • 111
  • 795
  • 1
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Ngày tải lên : 30/03/2014, 04:20
... components of this reaction include the dissociation of large a- crystallin and j-casein oligomers into smaller species, binding of a- crystallin to j-casein, conformational alteration of j-casein and ... formation by a- synuclein (125 lM) in the absence and presence of aB-crystallin (62.5 lM) (A) TFT binding data aB-crystallin was added to the incubated a- synuclein samples (black diamond) at the ... fibril formation a- Synuclein (250 lm) was incubated in NaCl ⁄ Pi at 37 °C At 0, 25, 49 and 65 h of incubation, aB-crystallin was added to the samples containing a- synuclein at a 0.5 : 1.0 molar ratio...
  • 16
  • 577
  • 0
Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx

Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx

Ngày tải lên : 30/03/2014, 04:20
... Stains-all staining; lane C, negative staining; lane D, Methyl green staining Arrows on the right side of the lanes indicate the position of the 52 kDa component A weakly stained band in lane A ... Eventually, the molecular mass of the mature protein was estimated to be 44 490.85 Da, containing 49 7 amino acid residues The amino acid composition of the deduced protein was characterized by a high ... pellet at approxi2978 Fig SDS ⁄ PAGE electrophoretogram of GISM in the OM of C nippona The same amount of sample was applied to each lane Lane M, molecular mass standards; lane A, CBB staining; lane...
  • 13
  • 425
  • 0
Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt

Ngày tải lên : 30/03/2014, 11:20
... )6 64 to )680 of PAI-1 promoter containing the jB-binding site but not by mutated fragment )6 64 to )680 of PAI-1 promoter NAC abolished NF-jB activation, indicating that TNFa- and H2O2-induced activation ... synthesized cDNA were amplified in triplicate for both b-actin and each of the target genes to create a standard curve Likewise, lL of cDNA was amplified in triplicate in all isolated samples for each primer ... TNFa in the presence or absence of NAC NF-jB promoter activation by TNFa was inhibited by antioxidant, NAC (Fig 3D) To confirm the role of fragment ()6 64 to )680) of PAI-1 promoter in this reaction,...
  • 11
  • 393
  • 0
báo cáo hóa học: "Impact of gastroesophageal reflux disease on patients'''' daily lives: a European observational study in the primary care setting" doc

báo cáo hóa học: "Impact of gastroesophageal reflux disease on patients'''' daily lives: a European observational study in the primary care setting" doc

Ngày tải lên : 18/06/2014, 18:20
... lives These data indicate a need for an improved approach to GERD management in the primary care setting, tailoring treatment on an individual basis in order to lessen the impact of the disease This ... interpretation and manuscript preparation Data analysis was provided by AstraZeneca All authors read and approved the final submission 13 14 Additional material 15 Additional file Extra-esophageal ... http://www.hqlo.com/content/7/1/60 3.25 (Germany) to 3 .43 (Spain) for other acid-related gastrointestinal symptoms The mean overall impact score ranged from 3.30 (Germany) to 3.51 (Spain) Among extra-esophageal...
  • 8
  • 521
  • 0
báo cáo hóa học: " The comparative burden of mild, moderate and severe Fibromyalgia: results from a cross-sectional survey in the United States" pdf

báo cáo hóa học: " The comparative burden of mild, moderate and severe Fibromyalgia: results from a cross-sectional survey in the United States" pdf

Ngày tải lên : 20/06/2014, 15:20
... numeric rating scale ranging from (indicating no pain) to 10 (indicating pain as bad as you can imagine) Higher scores indicate greater pain severity Based on previous analyses, scores of to are considered ... trials for FM therapies and aspects of domains and outcome measures that should be part of a concerted research agenda for FM researchers [12] The identified domains included pain, patient global ... contributors to the analysis and discussion sections All authors have read and approved the final manuscript Competing interests This study was funded by Pfizer, Inc Arthi Chandran and Gergana Zlateva are...
  • 13
  • 368
  • 0
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx

Ngày tải lên : 22/06/2014, 02:20
... restricted domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of ... stability of the linear functional equation,” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–2 24, 1 941 D H Hyers, G Isac, and Th M Rassias, Stability ... 2 Journal of Inequalities and Applications in the spaces of generalized functions Also, we obtain the general solution and prove the Hyers-Ulam stability of 1.1 in the spaces of generalized functions...
  • 12
  • 311
  • 0