scheduling messages with offsets on controller area network a major performance boost
CAN Controller Area Network docx
... means that messages remain intact after arbitration is completed even if collisions are detected All the arbitration takes place without corruption or delay of the message that wins the arbitration ... extra delay between the preceding and the succeeding data or remote frames Data frames and remote frames are separated from preceding frames by an interframe space 16 10/14/2012 Standard Data Frame ... implemented to maintain the initial synchronization that was established by the hard synchronization • Without resynchronization, the receiving nodes could get out of synchronization due to oscillator drift...
- 36
- 243
- 1
Controller area network dowload
... than adequate for vehicles a decade ago In 2004, GM moved to their next generation data bus system which they called "GMLAN" (GM Local Area Network) Introduced on the Cadillac XLR and Saturn Ion, ... CAN standard is that CAN as well as other protocols such as SAE J1939, GMLAN, OBD II, SAE J1587 and LIN have more to with the way information is formatted, transmitted and received than how fast ... bus with a "Class A" speed rating is a relatively slow, low-speed circuit that typically carries less than 10 kilobits (10 Kbps) of information per second A data bus that operates at Class A speeds...
- 9
- 300
- 2
AN0713 controller area network (CAN) basics
... Data Frames consist of fields that provide additional information about the message as defined by the CAN specification Embedded in the Data Frames are Arbitration Fields, Control Fields, Data Fields, ... erroneous message is aborted and the frame is repeated as soon as the message can again win arbitration on the network Also, each node is in one of three error states, Error-Active, Error-Passive or ... Overload Notification Recovery Management Medium Access Control (MAC) • • • • Data Encapsulation/Decapsulation Frame Coding (Stuffing/Destuffing)] Error Detection/Signalling Serialization/Deserialization...
- 9
- 156
- 0
báo cáo khoa học:" Functioning and health in patients with cancer on home-parenteral nutrition: a qualitative study" ppt
... adequate command of the German language Additional inclusion criterion for stage was that HPN had been administered at least seven and up to 20 days Additional inclusion criterion for stage was ... procedure was restricted to the second level of the ICF See Table for a scheme of qualitative data analysis and linking Sample size Data analysis Qualitative Data Analysis The Meaning Condensation Procedure ... most relevant aspects of functioning and are sensitive enough to monitor change associated to an intervention such as HPN in a vulnerable population with cancer Additional material Additional file...
- 11
- 275
- 0
System on chip design of a high performance low power full hardware cabac encoder in h 264 AVC
... Review of Arithmetic Coding and CABAC acceleration of renormalization and bit output of BAC In some situations, long delay can be caused when large number of OS bits are accumulated Ratio (Value) ... software implementation, algorithm modification and simplification, and hardware acceleration of codec system or particular function blocks by either FPGA or ASIC designs For SW acceleration, ... target at a wide range of applications and high compression capability 1.1 Overview of H.264/AVC Standard H.264/AVC was jointly developed by ITU-T and ISO/IEC, and gained rapid adoptions in a...
- 200
- 500
- 0
On line tuning of a neural PID controller based on variable structure RBF network
... to as dynamic orthogonal structure adaptation (DOSA) algorithm The algorithm can achieve compact network structure by employing a small number of parameters It takes advantage of a sliding data ... (1991) Kadirkamanathan, V., Niranjan, M.: A Function Estimation Approach to Sequential Learning with Neural Network Neur Comput 5, 954–975 (1993) Lu, Y.W., Sundararajan, N., Saratchandran, P.: ... Identification of time-varying nonlinear systems using minimal radial basis function neural networks IEE Proc Contr Theor Appl 144, 202–208 (1997) Huang, G.B., Saratchandran, P., Sundararajan, N.: A...
- 11
- 456
- 0
Báo cáo y học: "Influence of Cyclodextrin Complexation with NSAIDs on NSAID/Cold Stress-Induced Gastric Ulceration in Rats"
... Piroxicam was obtained from Sigma-Aldrich Chemical Company (St Louis, MO, USA) All remaining chemicals were analytical grade Preparation of CD Solutions An aqueous solution of each CD was prepared ... oral treatment with indomethacin and piroxicam each alone and after complexation of each with β-CD or HP-β-CD Materials and Methods β-Cyclodextrin was purchased from Acros Organics (Morris Plains, ... complexation on piroxicam gel formulations Acta Pharma 2005; 55: 223-36 30 Xiliang G, Yu Y, Guoyan Z, et al Study of inclusion interaction of piroxicam with β-CD derivatives Spectrochimica Acta Part A...
- 8
- 529
- 0
LÝ THUYẾT VỀ MẠNG LAN (LOCAL AREA NETWORK)
... Area Network - WAN) • Mạng thành phố ( Metropolita Area Network - MAN) • Mạng toàn cầu ( Global Area Network - GAN) • Mạng cá nhân ( Personal Area Network - PAN) • Mạng Lưu trữ ( Storage Area ... quốc gia.Có thể coi mạng WAN gồm nhiều mạng LAN kết nối với Ví dụ mạng WAN: ISDN (Integrated Services Data Network) , frame relay, SMDS (Switched Multimegabit Data Service) ATM (Asynchronous Transfer ... định, native VLAN, management VLAN user VLAN thành viên VLAN Tất giao diện Ethernet switch Catalyst mặc định thuộc VLAN Các thiết bị gắn với giao diện thành viên VLAN 1, trừ giao diện cấu hình sang...
- 109
- 1,754
- 6
Wireless Local Area Network
... RA/BSSID SA/TA Tới DS Chức Từ AP(hồng ngoại ) WDS (Cầu nối ) Từ DS Đ a Đ a Đ a DA BSSID SA 1 RA TA DA DS Server AP TA/BSSID Clien t RA/DA TA Đ a Không dùng SA SA 802.11 SA DA DS R A 802.11 AP DA AP ... có AP,DS Đ a DA Đ a SA MAC#2 Chức Đ a BSSID MAC#1 Đ a Không dùng Chức Tới DS Từ DS Đ a Đ a Đ a Đ a TớiAP(hồng ngoại ) BSSID SA DA Không dùng 19 BSSID tạo ngẫu nhiên 802.11 AP Khách Máy chủ RA/BSSID ... thông – WLAN + ADSL 30 Nhứng ứng dụng tích hợp với viễn thông - VoWLAN 31 Broadband Modem WLAN Multi-Home Gateway VoIP Gateway POE Switch Hub WLAN Access Point WLAN VoIP Phone Application in Enterprise...
- 34
- 473
- 1
Tài liệu tiếng anh Điện tử công suất mạch MERS A new AC current switch called MERS with low on state voltage IGBTs for renewable energy and power saving applications
... common A 3-level configuration is shown in Fig 9 (a) Permanent magnet generators applied to wind power generation have typically a high synchronous reactance, (in the area of per unit) With a pure ... Series connection of IGBTs (a) Time-trends of voltage sharing of three IGBTs for the case of 1000 Hz and 100 A (b)Configuration [2] K Shimada, T Takaku, T Matsukawa, and R Shimada, “Bi-directional current ... Device related characteristics are: • Line frequency switching: one switch is only turned on and off once during a fundamental cycle meaning low C Applications Several types of applications have been...
- 8
- 888
- 1
Chương trình quản lý đào tạo chạy trong môi trường mạng LAN (local area network)
... NHANVIEN Bởi phân đoạn quan hệ GIAOVIEN đợc định ngh a nh sau: GIAOVIEN1 = GIAOVIEN SJMaso = Maso NHANVIEN1 GIAOVIEN2 = GIAOVIEN SJMaso = Maso NHANVIEN2 ta sử dụng phép toán n a nối quan hệ GIAOVIEN ... GIAOVIEN NHANVIEN1, NHANVIEN2 Ta mô tả đầy đủ điều kiện tham chiếu hai đoạn là: q1: GIAOVIEN.Maso = NHANVIEN.Maso AND NHANVIEN.Truong = Phan Đình Phùng q2: GIAOVIEN.Maso = NHANVIEN.Maso AND Chơng ... đoạn ngang d a phân đoạn dọc ví dụ trớc: NHANVIEN1 = SL MaNV
- 60
- 544
- 0
Thiết lập và định cấu hình cho một mạng LAN (Local Area Network)
... lý và phát hiện lỗi. Các máy tính trong mạng phải có đ a chỉ IP không trùng nhau và phải cùng một Subnet Mask (xem hình 02) Sau khi đã hoàn tất các bước trên thì các nút, các máy tính trong mạng LAN c a bạn đã có thể trao đổi thông tin cho nhau, chia sẻ tài nguyên gi a các ... computer > Control Panel > Network > nếu tại đây bạn đã thấy có giao thức TCP/IP rồi thì bạn khỏi cần add thêm nếu ch a có thì bạn hãy click chọn vào nút ADD > vào c a sồ Add Component > sau đó bạn chọn giống như hình > chọn OK. ... lạc được với nhau, bạn không cần phải quan tâm gán IP n a. Gán IP theo dạng tĩnh (Static): Nếu bạn có nhu cầu là thiết lập mạng để chia sẻ tài nguyên trên mạng như, máy in, chia sẻ file, cài đặt mail offline, hay bạn sẽ cài share internet trên một máy bất kỳ, sau đó định cấu hình cho các máy ...
- 4
- 457
- 1
Tài liệu Insight into Alternative Approaches for Control of Avian Influenza in Poultry, with Emphasis on Highly Pathogenic H5N1 doc
... Pennsylvania, USA in early 1980s, one of control proposals was the use of amantadine as a therapeutic and/or prophylactic approach Under experimental condition, amantadine given in drinking water was ... In addition to its antiviral activity, these extracts often have anti-bacterial, anti-fungal, anti-inflammatory, anti-oxidant and/or analgesic properties which may provide alternative natural ... effect • Dual use as a vaccine-vector and immunomodulator • Efficacy against AIV particularly HPAIV is still questionable Chemotherapy M2 Blockers (Amantadine and Rimantadine) and Neuraminidase inhibitors...
- 30
- 545
- 0
Tài liệu Biodiversity and Local Perceptions on the Edge of a Conservation Area, Khe Tran Village, Vietnam doc
... vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia glabrata/tree Licuala spinosa/Licuala palm Tarrietia javanica/tree Cleistanthus aff myrianthus/tree ... National Library of Indonesia Cataloging-in-Publication Data Boissière, Manuel Biodiversity and local perceptions on the edge of a conservation area, Khe Tran village, Vietnam/ by Manuel ... stony and hard soil surface Le Trong Trai et al (2001) argued that with an abundance of heavily degraded land available for rehabilitation, forest management and other land uses, there is considerable...
- 118
- 556
- 0
Chapter 13 :Local Area Network Technology potx
... Central node can broadcast Physical star, logical bus Only one station can transmit at a time Central node can act as frame switch Media Access Control Where Central Greater control ... checking (ACK) May be more than one packet on ring Buffer for retransmission later Bypass State Signals propagate past repeater with no delay (other than propagation delay) Partial solution ... LAN Applications (1) Personal computer LANs Low cost Limited data rate Back end networks and storage area networks Interconnecting large systems (mainframes and large storage devices)...
- 72
- 740
- 2
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A FEBS Journal 273 (2006)...
- 11
- 548
- 0
Báo cáo khoa học: "EXPERIENCES WITH AN ON-LINE TRANSLATING DIALOGUE SYSTEM" docx
... that this kana-tokanji conversion, which is accepted as a normal part of Japanese word-processor usage, is in fact a natural form of pre-editing, given that it serves as a partial disambiguation ... Osaka) into the nature of keyboard dialogues (Arita et aL 1987; Iida 1987) mainly aimed at comparing telephone and keyboard conversions They have concluded that keyboard has the same fundamental ... write This has a significant effect on conversational strategy, and occasionally leads to disjointed conversations, both in monolingual and bilingual dialogues For example, a user might start to reply...
- 8
- 331
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008