scan the text and complete each of the following sentences with a word or a number

Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

Ngày tải lên : 23/03/2014, 13:20
... suitability of a conjugate of the synthetic CPP MAP (KLALKLALKALKAALKLANH2) [9,10] with a 12-mer peptide nucleic acid (5¢-GGAGCAGGAAAG-3¢) directed against the mRNA of the nociceptin/orphanin FQ receptor ... differentiation between the permeation behavior of I and II appears possible on the basis of the CLSM data, except that a lower rate of re-export became apparent for the conjugate (Fig 1) FACS, on the ... Conjugation with MAP leads to an increased intracellular availability of PNA In order to examine the ability of MAP to deliver PNA into intact cells, we investigated the cellular uptake of the...
  • 7
  • 325
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Ngày tải lên : 23/03/2014, 07:20
... revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and vacuolar segregation ... in S cerevisiae was constructed by PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse ... primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a...
  • 11
  • 427
  • 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Ngày tải lên : 23/03/2014, 20:22
... to the region )148 to )124 of c-jun and stimulates transcription Materials and methods Reagents and animals All chemicals were of reagent grade and were from Sigma Chemical Co unless stated otherwise ... earlier After 15 min, the reaction mixture was placed on ice and UV irradiated (254 nm) for 15 [25] Following irradiation, the mixture was separated by SDS/PAGE (15% acrylamide) and analysed by autoradiography ... for The lysates were assayed for both GFP and b-galactosidase activity GFP activity was assessed by measuring the fluorescence at 480 nm (excitation maximum) and 507 nm (emission maximum) in a...
  • 9
  • 449
  • 0
– THE SAT WRITING SECTION – Identifying Sentence Errors Each of the following sentences has pot

– THE SAT WRITING SECTION – Identifying Sentence Errors Each of the following sentences has pot

Ngày tải lên : 18/06/2014, 17:20
... beginning of the essay, and the rest of the essay serves to develop and support that idea The same happens on the paragraph level; each paragraph has one main idea, often expressed in a topic sentence ... history, and speculation in The Woman Warrior, a memoir which was both award winning and a best-seller a The Woman Warrior, a memoir which was both award winning and a best-seller b The Woman Warrior, ... improve the introduction of the paragraph? Unity of Ideas As stated earlier, a paragraph is a group of sentences about the same idea Frequently a passage will include one or more sentences that stray...
  • 28
  • 489
  • 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20
... investigating risk factors associated with general physical and mental health, and post-traumatic stress disorder (PTSD) and depression amongst IDPs in northern Uganda Further details of the broader ... Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf .or. jp/news/baseline/Baseline.pdf] ... Acknowledgements Assistance with data for the sample frame was provided by the World Food Programme (Gulu Office) and the International Organisation for Migration (Gulu Office) This work was supported by the...
  • 10
  • 647
  • 0
Báo cáo hóa học: " The relation between Ashworth scores and neuromechanical measurements of spasticity following stroke" doc

Báo cáo hóa học: " The relation between Ashworth scores and neuromechanical measurements of spasticity following stroke" doc

Ngày tải lên : 19/06/2014, 08:20
... characterize the nature and origins of mechanical abnormalities associated with spasticity – these remain fundamental issues in our field This information is also valuable for diagnosis and therapy, as these ... dependency of mechanical abnormalities and Ashworth score We examined the position-dependent data for each of reflex and intrinsic mechanisms at each elbow and ankle joint separately To correlate our ... physical therapist, who had been well trained and had several years experience in MAS measurement The MAS was applied to the paretic joints of both the ankle and elbow Ashworth and Modified Ashworth...
  • 14
  • 514
  • 0
Báo cáo y học: "The clinical-familial correlates and naturalistic outcome of panic-disorder-agoraphobia with and without lifetime bipolar II comorbidity" potx

Báo cáo y học: "The clinical-familial correlates and naturalistic outcome of panic-disorder-agoraphobia with and without lifetime bipolar II comorbidity" potx

Ngày tải lên : 08/08/2014, 23:21
... in a significant minority of cases, PD and BP-II may share common familial and genetic factors, and these factors may influence the earliest manifestations of the panic-agoraphobic syndrome and ... and GT evaluated all the patients under the supervision of CT and GP GP performed the statistical analysis All authors read and approved the final manuscript Page of (page number not for citation ... course of the illness and comorbidity with other mental disorders; and (4) affective temperaments according to Akiskal and Mallya [42] criteria and avoidant and dependent personality disorders according...
  • 9
  • 410
  • 0
báo cáo khoa học:" Experiences and barriers to Health-Related Quality of Life following liver transplantation: a qualitative analysis of the perspectives of pediatric patients and their parents" docx

báo cáo khoa học:" Experiences and barriers to Health-Related Quality of Life following liver transplantation: a qualitative analysis of the perspectives of pediatric patients and their parents" docx

Ngày tải lên : 12/08/2014, 01:22
... Results A total of 42 pediatric patients (64% female and 36% male; average age of 12 years) and parents (84% mothers and 16% fathers) participated in qualitative interviews All participating patients ... Experiences and barriers to HealthRelated Quality of Life following liver transplantation: a qualitative analysis of the perspectives of pediatric patients and their parents Health and Quality of Life ... Institute, The Hospital for Sick Children, University of Toronto, Toronto, Ontario, Canada 2University of Calgary, Faculty of Social Work, Central and Northern Alberta Region, Edmonton, Alberta, Canada...
  • 8
  • 341
  • 0
Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx

Báo cáo khoa học: "The impact of empiric antimicrobial therapy with a β-lactam and fluoroquinolone on mortality for patients hospitalized with severe pneumonia" pptx

Ngày tải lên : 12/08/2014, 23:20
... preparation of the paper MIR, AA, and JP contributed to the design of the study, the analysis of the data, and preparation of the paper All authors read and approved the final manuscript Acknowledgements ... 15 Martinez JA, Horcajada JP, Almela M, Marco F, Soriano A, Garcia E, Marco MA, Torres A, Mensa J: Addition of a macrolide to a beta-lactam-based empirical antibiotic regimen is associated with ... assessed with information from the Texas Department of Health and the Department of Veteran Affairs clinical database Mortality status was assessed up to the end of December 2002 Antimicrobial therapy...
  • 8
  • 347
  • 0
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A joint revision by SCANTEM, TARN, DGU-TR and RITG" ppt

Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A joint revision by SCANTEM, TARN, DGU-TR and RITG" ppt

Ngày tải lên : 13/08/2014, 23:20
... on Scandinavian MTOS and Trauma Registry: Feasibility of comparing core data from existing trauma registries in Scandinavia Reaching for a Scandinavian major trauma outcome study (MTOS) Scand ... Table 3: Predictive model variables Data variable no Data variable name Type of data Data variable categories or values Definition of data variable Age Continuous Number The patient's age at the ... http://www.sjtrem.com/content/16/1/7 Table 5: Process mapping variables Data variable no Data variable name Type of data Data variable categories or values Definition of data variable 32 Time from alarm to arrival at scene...
  • 19
  • 340
  • 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Ngày tải lên : 30/03/2014, 10:20
... domain folding topology with six b-strands (bA to bF) and two a- helices (aA and aB) (Fig 4) The structure of the C378G variant of SAP97PDZ2 was practically identical to that of C378S variant, ... residues of A1 8 peptide are visible in the complex as an extended b-strand sandwiched between aB and bB and antiparallel to the b-strand (Fig 6A) The terminal carboxylate group of Leu907 forms hydrogen ... to thank the beamline personnel for assistance in data collection We thank D Bansfield for technical assistance This work was supported by grants from the Academy of Finland to AG (1105157), and...
  • 11
  • 458
  • 0
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot

Ngày tải lên : 06/08/2014, 05:20
... convolution with a weightfunction for the Cosine - Fourier integral transform, Acta Math Vietnam 29 (2004) 149–162 15 Nguyen Xuan Thao and Nguyen Thanh Hai, Convolution for Integral Transforms and Their ... Integral Transforms and Special Functions (1996) 235–242 11 Nguyen Thanh Hai and S B Yakubovich, The double Mellin - barners type integrals and their applications to convolution theory, Word Sci ... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich,...
  • 16
  • 336
  • 0
Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Ngày tải lên : 07/08/2014, 06:20
... is easily seen that the ratio of the two versions of λ tends to and also that the theorems for either version of λ imply the theorems for the other version Since the the electronic journal of ... that each of the bipartite graphs formed by restricting the covering relation of P to two adjacent ranks be regular in the graph theoretic sense.) For example, both the subsets of a set and the ... d-dimensional subspace of GF(q)n has the same number of ordered bases, the fraction of ordered bases with a desired property will be the same as the fraction of d-dimensional subspaces with the property...
  • 8
  • 421
  • 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Ngày tải lên : 10/08/2014, 09:22
... dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally ... limited capacity for remodelling of the myocardium, to abnormal coronary arterial anatomy, to limited coronary arterial adaptation capacity or to other factors is yet unknown However, an important ... for cardiac transplantation at ages 33, 34 and 47 respectively These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia...
  • 7
  • 387
  • 0
Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx

Báo cáo y học: " Carcinoid tumor of the verumontanum (colliculus seminalis) of the prostatic urethra with a coexisting prostatic adenocarcinoma: a case report" docx

Ngày tải lên : 11/08/2014, 14:21
... Kneale K, Lalak N, Delprado W: Carcinoid tumors of the urinary tract and prostate Arch Pathol Lab Med 2006, 130(11):1693-1706 Katayama M, Hara A, Hirose Y, Yamada Y, Kuno T, Sakata K, Morioka ... performed the original histological examination of the prostate, interpreted and diagnosed the pathology findings, prepared the figures and did the literature review All authors read and approved the ... “urethra” and “carcinoid” only four articles are found, each reporting a single additional case of a urethral carcinoid tumor [1-4] The first case of urethral carcinoid, reported by Sylora et al...
  • 4
  • 226
  • 0
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Ngày tải lên : 12/08/2014, 18:20
... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing /the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References ... SEM Each value was analysed using Mann-Whitney (between two groups) or anlaysis of variance (ANOVA; among three groups) tests Statistical significance was considered at P < 0.05 The number of bacteria...
  • 2
  • 450
  • 0
Báo cáo y học: "he outcome of patients presenting to the emergency department with severe sepsis or septic shock" doc

Báo cáo y học: "he outcome of patients presenting to the emergency department with severe sepsis or septic shock" doc

Ngày tải lên : 13/08/2014, 01:20
... transmit other signals The early use of vasopressors is not necessarily a sign of an aggressive level of care; it may be a sign of inadequate volume resuscitation and of resorting to vasopressors ... Serum lactate and base deficit as predictors of mortality and morbidity Am J Surg 2003, 185:485-491 Berkman MR, Shapiro N: Anion gap as a screening tool for elevated lactate in patients with an increased ... albumin with crystallinoid fluid therapy conducted in New Zealand and Australia [11] found a sepsis mortality of 30.735.3% The patients with acute respiratory distress syndrome had an even higher mortality...
  • 3
  • 150
  • 0
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx

Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx

Ngày tải lên : 13/08/2014, 23:20
... combination of such databases, the management of missing data and the sensible exploration of large-scale data For now, both approaches are valid A robust, clearly defined core dataset common to all ... Important for this will be legislative policy at national and European levels to support the development of an informatics infrastructure for trauma and the collection of such data on a population-wide ... the diagnostics, morbidity and outcome data on these patients We have enough computer processing power and data storage for these needs New statistical and data-mining techniques allow for the...
  • 2
  • 246
  • 0
LX Thuy_tính toán vỏ có lỗ giảm yếu và gân gia cường chịu sóng xung kích: Effect of Some Factors on the Dynamic Response of  Reinforced Cylindrical Shell with a Hole on Elastic  Supports Subjected to Blast Loading

LX Thuy_tính toán vỏ có lỗ giảm yếu và gân gia cường chịu sóng xung kích: Effect of Some Factors on the Dynamic Response of Reinforced Cylindrical Shell with a Hole on Elastic Supports Subjected to Blast Loading

Ngày tải lên : 02/11/2016, 22:48
... the problem with two cases: Case 1: (basic problem): The shell has a square (a x a) abatement hole in the middle position, with a = 0.3 m; Case 2: The shell has no hole (a = 0) Acting load: the ... at the calculated point are expressed in table and Figures 11, 12, 13, 14 0.04 4.2 The effects of the size of the hole Table Extreme values of calculated quantities at point A when the size a ... shell has a square abatement hole with the side a = 0.3 m (Basic problem): Using the established Stiffened_SC_Shell _withhole program, the authors solved the problem with the calculating time tcal...
  • 8
  • 772
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Ngày tải lên : 18/02/2014, 16:20
... (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined The F13 3A mutation ... mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) The mutations were verified by DNA sequencing ... present in the E chain, and part of the His-tag was observed in the B chain A few amino acid residues are found in disallowed regions in the Ramachandran plot; these are A4 , A1 65, A1 67, B3, B4 and F165,...
  • 12
  • 656
  • 0