sample c sharp programs for beginners pdf
Building C++CLI Programs for the .NET Developer Platform with Visual C++
Ngày tải lên :
05/10/2013, 07:20
... mode, except for the
code in Chapter 12, which deals specifically with unverifiable code, and code that uses specific
constructs such as unsafe uses of static_cast. If you’re familiar with C# , ... any specific processor architecture. However, as
you’ve seen, code compiled with /clr rather than /clr:pure or /clr:safe may contain plat-
form-specific code. Also, even in pure mode, you can invoke ... compiler (or cross-compiler) for that
architecture. Visual C+ + 2005 ships cross-compilers for x64 and Intel Itanium architectures, so
you can generate code on an x86 computer that will execute...
- 14
- 485
- 0
Candle Making Craft For Beginners pdf
Ngày tải lên :
11/03/2014, 13:20
... to form abstract colored candles.
COFFEE BEANS
Add coffee beans to the base of your molds and coffee essence to the wax for the fragrance. Gently
pour in the wax.
COLORED BEANS
Add colored ... Candle
7. Candle Making Projects - Votive Candles
8. Candle Making Projects - Marble Candles
9. Candle Making Projects - Ice Candles
10. Candle Making Projects - Innovative Candle Ideas
ENJOY AND ... DISCOVER.
1. CONTENTS
Introduction
Equipment You Need for Candle Making
Tips to be Aware of for Better Candle Making
Candle Making Safety
Making Your Own Candles
- Two Colored Pillar Candle
...
- 27
- 558
- 0
Canvas Painting for Beginners pdf
Ngày tải lên :
31/03/2014, 14:20
... All links are for information
purposes only and are not warranted for content, accuracy or any other implied or explicit
purpose.
1) Baroque – Caravaggio, Carracci
2) Classicism – Mengs, ... perfect. Be
careful not to let the fabric touch the art piece. You can actually buy extender clamps to
attach to your canvas at the top. This allows the covering to drape without coming in
contact ... perspective.
Pigment – The colored substance created by natural elements and synthetic ones which
are mixed with certain binders to create paints.
Primary colors – A color which can not be created...
- 40
- 405
- 0
C Sharp 2.0 Practical Guide For Programmers
Ngày tải lên :
20/08/2012, 11:57
... below, one for C (Compilers .C) and another
for C# (Compilers.Csharp), can own (and access) different classes with the same name.
Therefore, Lexer and Parser for the C compiler are accessed without ... are associated with the namespaces Compilers .C and Compilers.Csharp,
respectively:
namespace Compilers .C {
class Lexer { }
class Parser { }
}
namespace Compilers.Csharp {
class Lexer { }
class ... System.Collections; // To access ArrayList class.
2
3 namespace Co {
4 namespace System {
5 namespace Collections {
6 public class OurList { /* */ }
7 //
8}
9}
10 namespace Project {
11 public class...
- 273
- 617
- 2
Giải thuật C Sharp.pdf
Ngày tải lên :
23/08/2012, 13:21
... c c ô nhận t c
động Click để đặt ống vào, mảng 1 chiều array2[5] hoạt động như một hàng
đợi. Một mảng 1 chiều array3[7] dùng để chứa tất c c c loại ống. Mỗi phần
tử c a 3 mảng này gồm c c c ... c c biến ‘in’ ‘out’ ‘nen’ nhằm để kiểm tra dầu
c thể tiếp t c chảy hay không và m_button thu c CBitmapButton để ta c
thể đặt c c bitmap lên button.
Do đó 3 mảng c kiểu là một c u tr c gồm ... gồm c c c biến ‘in’ ‘out’ ‘nen’
và m_button và trong chương trình ta c sử dụng phép gán giửa hai phần tử
c a mảng vì vậy ta xây dựng một lớp là CMang
class CMang : public CWnd
{
public:...
- 9
- 697
- 0
Tài liệu C Sharp part 13 pdf
Ngày tải lên :
15/12/2013, 01:16
... FileStream(this.FullPath, FileMode.Open, Fi
leAccess
.Read);
///Create byte array.
Byte[] _oByte = new byte[1024];
///Create UTF8Encoding.
UTF8Encoding _oUTF8Encoding = new UTF8Encoding();
///while filestream ... declare.");
else{
///check file exists, throw exception if it isn't exist.
if (System.IO.File.Exists(this.FullPath))
{
///Create filestream with filemode open and fileaccess ...
///check file path. throw exception if is null or empty.
if(this.FullPath == null || this.FullPath.Equals(""))
///throw exception.
throw new Exception("Can not get content!...
- 3
- 365
- 0
Tài liệu C Sharp part6 pdf
Ngày tải lên :
15/12/2013, 02:15
... V_1,class yyy V_2)
8: ldc.i4.s 10
9: newobj instance void yyy::.ctor(int32)
10: stloc.0
11: ldc.i4.5
12: newobj instance void yyy::.ctor(int32)
13: stloc.1
14: ldloc.0
15: ldloc.1
16: call ...
25:
26: .class public auto ansi yyy extends [mscorlib]System.Object
27: {
28: .field public int32 i
29: .method public hidebysig specialname static class yyy op_Addition(class yyy x,class
yyy ...
M c dù chúng ta viết mã trong C# c quá tải toán tử như vậy, nhưng trình biên dịch
C# sẽ phải dịch ra ngôn ngữ trung gian IL để th c thi trên môi trường .NET. Đoạn
lệnh đã đư c biên dịch ra...
- 3
- 320
- 0
Tài liệu C Sharp part12 pdf
Ngày tải lên :
15/12/2013, 02:15
...
{
this._sName = name;
}
}
}
Mình không c nhiều thời gian nên c c bạn c thể tự tìm hiểu thêm, chú c c đến
Enumerator c a AttributeTargets.
Sử dụng Attribute tự t
ạo tương ... Ví dụ 3!
Creating Custom Attributes(tạo một Attributes)
* Lớp tạo Attributes
PHP Code:
/*
* Created by SharpDevelop.
* NetDevelop Co., Ltd.
* Author: Tuan Anh Nguyen Ngoc
* Date: ... Ngoc
* Date: 11/24/2006
* Contact Information.
* - Email: info.netdevelop@gmail.com
* - Handheld: +84 905 202 088
*/
using System;
namespace AdvancedDotnet
{
/// <summary>...
- 2
- 263
- 0
Tài liệu Develop computer programs for simplifying sums that involve binomial coefficients: The Art of Computer Programming, Volume 1: Fundamental Algorithms pdf
Ngày tải lên :
20/12/2013, 19:15
... your
pet chimpanzee could check out the equation. More precisely it means this. First
cancel out all factors that look like c
n
or c
k
(in this case, a factor of 2
−n
) that can be
cancelled. ... arithmetic-geometric-mean inequality; Euler’s
(a
2
+ b
2
+ c
2
+ d
2
)(A
2
+ B
2
+ C
2
+ D
2
)=
(aA + bB + cC + dD)
2
+(aB − bA − cD + dC)
2
+(aC + bD − cA − dB)
2
+(aD − bC + cB − dA)
2
, (1.3.2)
Foreword
Science ... rapidly converging series. This enabled him (or his human
computers) to compile highly accurate tables of his elliptic functions, and hence, of
course, of the incomplete elliptic integral F (z). Much...
- 222
- 550
- 0
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf
Ngày tải lên :
06/03/2014, 04:20
... was:
Forward primer (FW) 5-
TCCGCTGCCAGTCGTCTTCC-3 and
Reverse primer (RW) 5-
GTCCTCGCGAGTCTAGGCCA – 3.
Amplification reaction was performed in 25 l of
master cocktail containing ... quantification of mycobacterial
Fig. 6—Representative agarose gel electrophoresis picture(s) of
C- PCR amplified products for the calculation of mycobacterial load
from peripheral blood specimens ... thawing protocol
10
for PCR analysis.
PCR analysis—PCR amplification was performed
on isolated DNA samples using specific primers for
MPB 64 gene of M. tuberculosis. The sequence of the
primers...
- 7
- 308
- 0
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf
Ngày tải lên :
16/03/2014, 18:20
... the concentration of sEPCR,
an anti-EPCR monoclonal antibody (RCR-2) was covalen-
tly immobilized on a carboxymethylated dextran (CM5)
sensor chip (BIAcore) using amine coupling chemistry,
according ... procedures). A nonreactive mAb was used as a
control for nonspeci c binding in the reference flow cell. Increasing
concentrations of wild-type sEPCR (13–106 n
M) were injected
across both flow cells. ... bind
anionic phospholipid surfaces [16,26,27] and is there-
fore crucial for its activity.
The crystal structures of recombinant sEPCR, and
sEPCR in complex with the Gla domain of protein C,
have recently...
- 12
- 409
- 0