s reidegeld ka meyer he warscheid b 2007 protein labeling by itraq a new tool for quantitative mass spectrometry in proteome research proteomics 7 340 350

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08
... encompasses chemical labelling and label-free mass- spectrometry- based proteomics and (iii) and protein- chipbased arrays There are advantages and disadvantages to both platforms and they are listed in ... 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion Chromatin Immunoprecipitation Database for Annotation, Visualization and Integrated Discovery ... Nimesulide Anti-cancer (Prostate) Antibiotics Anti-viral (HIV) DMARDb NSAID NSAID Perhexiline Simvastatin Sulindac Stavudine Anti-aginal Statinc NSAID NSAID Tolcapone Troglitazone Parkinson s < /b> Diabetes...
  • 226
  • 1.8K
  • 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Ngày tải lên : 19/02/2014, 13:20
... recombinant APC variants that are unable to bind heparin supports the Ó FEBS 2004 mechanism in which heparin binding to the basic cluster in APC is responsible for the observed inhibitory activity ... that heparin clashes against FVa and/or could be very close to negatively charged FVa residues Asp513, Asp 578 and Asp 577 and/or Asp659-Asp660-Asp661-Glu662-Asp663 (Fig 7A) Contact between FVa and ... we performed a kinetic analysis by using nonlinear regression analysis of initial rates of FVa inactivation by APC (initial rates representing almost exclusively cleavage at Arg506) at FVa concentrations...
  • 13
  • 654
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... and raises the possibility that the K99 side chain in both proteins can adopt two conformations stabilized by H-bond interactions Finally, a change in the side-chain orientation of F102 is observed ... coordinating the heme-iron [7] Interestingly, ligand exchange for the M100K variant at alkaline pH was not observed [7] , suggesting that the ‘alkaline transition’ involving the dissociation of the ... around the K100 ligand is less stable than in the wt protein This is also inferred from the structural data, where despite structural changes being minimal the trapping of two main-chain conformations...
  • 15
  • 509
  • 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Ngày tải lên : 08/03/2014, 16:20
... EDTA (pH 7. 4) Protein concentration was determined by the method of Bradford [33], using BSA as a standard Microsomal proteins separated by SDS/PAGE were blotted on PVDF membranes and incubated ... clones, similar to human SR-1 (TM7SF2), were retrieved by a BLASTN search in the EST database The putative cDNA of the bovine D14-SR was obtained by aligning four different clones (GenBank accession ... The cells were examined by ¯uorescence microscopy and the images were acquired by using a Spot-2 cooled camera (Diagnostic Instruments) Sterol D14-reductase assay D14-SR activity was assayed in...
  • 8
  • 493
  • 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Ngày tải lên : 16/03/2014, 11:20
... mU) was added to buffer solutions of DBZTC (10 lm) maintained in a 37 °C water bath The fluorescence emission of each reaction mixture was measured at 5-min intervals against a reagent blank using ... mixture was equilibrated and kept for before measurement As can be seen from Fig 6, fluorescence intensity was markedly suppressed by addition of SOD However, when SOD was replaced by heat-inactivated ... fluorescence intensity Hepes was used because it has been shown to be a better buffer for the incubation of mammalian cells, and may improve the planting efficiency of cell incubation and breed ability...
  • 9
  • 401
  • 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Ngày tải lên : 23/03/2014, 11:20
... Bioinformatical analyses revealed that SACCP shares characteristics with previously described members of the BCCP family of proteins by both having significant sequence similarity and containing ... accessible at the cell surface The biotinylated cells Heme protein identification in M capsulatus A C B Fig SDS ⁄ PAGE and protein immunoblot analyses of protein fractions obtained during the NaCl ... between Ala41 and His42 (Fig 1B) N-Terminal processing would lead to a mature protein of 73 2 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families...
  • 12
  • 392
  • 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Ngày tải lên : 07/08/2014, 20:23
... sesac sititsam enivob lacinilcbus morf detalosi sniarts 73 ,yduts tneserp eht nI snoitcefni lamina dna namuh ni negohtap a sa dezingocer neeb sah aps aps aps bnf suerua flc S < /b> 1 01 aoc suerua S < /b> ... AGATGTCTTGGAAGCCAATTAATG :esrever ATCGGTATTTAACTAGCCCTGAAA :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever ... noisuffid-raga citamorhcateM DP hcirpeoH ,C sigroegineG ,FVR acihcaL 21 083 suerua jes succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS suerua succocolyhpatS - 673 ,33...
  • 4
  • 138
  • 0
Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Ngày tải lên : 20/01/2014, 22:20
... NEA & SEA GEANT UK Sweden Germany France Spain Lithuania Poland NEA Austria Romania Italy TEIN 10Mbps KOREA CHINA JAPAN 45Mbps 16-45Mbps 12Mbps MALAYSIA SEA Singapore Int’l ICT, IR, USA 1Gbps ... Thailand 1Gbps APII 12Mbps Philippines Malaysia Singapore Indonesia Access Point Exchange Point TEIN APII Testbed Australia Int’l ICT, IR, Asia Pacific Information Infrastructure  At APEC Summit2 ... Cambodia, Myanmar, Malaysia, Brunei, Vietnam, Singapore, Indonesia, Philippine, Thailand, ASEM ASEAN Int’l ICT, IR, 27 Europe-Asia Link to SEA Korea France TEIN II Link (34Mbps) Malaysia Int’l...
  • 30
  • 362
  • 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Ngày tải lên : 16/03/2014, 18:20
... the absolute increases in PMLA levels in the extracts were the same for the white and the yellow strains Nevertheless, because the level in the cytoplasm of white plasmodia before injection was ... complexes in white plasmodia than in yellow plasmodia before the injection (because there is much less PMLA in the cytoplasm of white plasmodia; Table 1) By the same token, the equal (between-strains) ... phosphorylation, and no attempts were made to standardize the ELISA readings on an H1 mass basis Series of measurements were compared after standardization with a reference sample prepared by the...
  • 7
  • 325
  • 0
Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Ngày tải lên : 23/03/2014, 06:20
... areas chosen from a nationally representative sample used in the 1993 SUSENAS National North Sumatra, West Sumatra, South Sumatra, Lampung, DKI Jakarta, West Java, Central Java, Yogyakarta, East ... Java, Bali, West Nusa Tenggara, South Kalimantan and South Sulawesi 12 Socio-Demographic Survey.6 Over-sampling in urban and small province EAs allows for comparisons between urban and rural areas, ... Check hemoglobin levels ∗ The original survey was divided into two separate parts evaluating the initial and final prenatal visit; these parts were combined into one ‡ This variable was obtained...
  • 53
  • 369
  • 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

Ngày tải lên : 29/03/2014, 08:20
... high-molecular -mass antibacterial proteins in fish mucus, such as that of the rockfish (Sebastes schegeli), which demonstrates selective antibacterial activity against gram-negative bacteria [14] A pore-forming ... protein in the mucus of the giant African snail, also shows significant bacterial-binding and LAAO activity against S < /b> aureus and E coli [33] Escapin, from the ink of the sea hare, has an l-lysine-dependent ... indicated as a diagram M, positions of the molecular mass markers been reported that LAAOs have bioactivities as antibacterial, antiviral and cytotoxic agents in a variety of animal fluids, such as snake...
  • 13
  • 423
  • 0
The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

Ngày tải lên : 28/06/2014, 17:20
... (This file was produced from images generously made available by The Internet Archive/Canadian Libraries) Barbara Weinstock Lectures on The Morals of Trade HIGHER EDUCATION AND BUSINESS STANDARDS ... UNIVERSITY OF CALIFORNIA ALL RIGHTS RESERVED Published March 1918 The Riverside Press CAMBRIDGE · MASSACHUSETTS U S< /b> A BARBARA WEINSTOCK LECTURES ON THE MORALS OF TRADE This series will contain essays ... By Willard Eugene Hotchkiss CREATING CAPITAL: MONEYMAKING AS AN AIM IN BUSINESS By Frederick L Lipman IS CIVILIZATION A DISEASE? By Stanton Coit SOCIAL JUSTICE WITHOUT SOCIALISM By John Bates...
  • 109
  • 350
  • 0
The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

Ngày tải lên : 28/06/2014, 19:20
... changes by See Animals, Products, &c 22 24 Geese—see Poultry Guinea-hen—see ditto Hens—see Poultry Hinny—see Ass Horse—the Arabian and Barb the English American Arabians in America Ranger, the Barb— ... clicking 171 173 the bearing-rein the bit 178 179 174 175 175 175 176 176 176 177 178 stables comparative labor with oxen 180 190 Mule, the—breeding in the U S < /b> rearing and management advantages ... neat cattle, the Horse, the Mule, Sheep, and Swine A few Asses are bred, but for no other object than to keep up the supply of jacks for propagating mules We have also goats, rabbits, and the...
  • 794
  • 2.7K
  • 0
Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx

Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx

Ngày tải lên : 07/08/2014, 10:21
... collected in 19  research localities For the reason of the restricted length of this paper, tabular results of laboratory analyses (Tables 2–4) are published in shortened Table Chemical and physicochemical ... the soil is able to bind, V – basic saturation (saturation degree of the soil sorption complex by basic cations) For the reason of the restricted paper volume, tabular results of laboratory analyses ... reaching the substrate horizon C was dug at each site Soil taxonomy was described in excavated soil profiles applying the FAO WRB international classification Evaluation of underplanting damage...
  • 12
  • 529
  • 0
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf

Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf

Ngày tải lên : 08/08/2014, 01:22
... the effects of the salt, cold and freezing stresses applied and in a similar manner to that of herbaceous, deciduous angiosperms This raises the possibility that forest species may also be protected ... ninhydrin method [3] 2.5 Statistical analysis Factorial analysis of variance was carried out using SPSS for Windows (version 8) Tukeys’ HSD test was used for Post-Hoc testing RESULTS 3.1 Influence ... For studies on both cold and salt stresses, cultures were maintained for 14 days Every days, the flasks were briefly removed from the orbital shaker, the cells allowed to settle for 10 and the...
  • 4
  • 338
  • 0
Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps

Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps

Ngày tải lên : 08/08/2014, 18:21
... successive years Floodplain and riverbank oaks were less sensitive, even if floodplain oaks frequently damaged, specially during early spring These stands probably displayed a defence against early ... Russian] Tikhomirov AV (1989) Structure of the annual radial increment as an index of the state of the Common Oak In: Sostoyanie dubrav lesostepi Nauka, Moscow, 77 - 97 [in Russian] Utkina IA, ... the present work was analyse the dynamics of radial increment in forest-steppe oak stands during a 30 year period (1958-19 87) and to build a mathematical simulation allowing a quantitative The...
  • 6
  • 263
  • 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Ngày tải lên : 08/08/2014, 19:21
... effects seem to be mainly inby stomatal limitation to photosyn- duced thesis Disorders in the photosynthetic apparatus appeared, nevertheless, at higher stress intensities in all species but were ... ones for both Q petraea and Q robur, but not for Q cerris, for which the decreases reached the same extent in both cases Decreases in F were always the conm /F v sequence of both a slight increase ... and g ψ decreased Decreases in A w wp as began above -1.0 MPa but were gradual Values close to zero were obtained in all cases when wp ψ reached -3.5 MPa The decline of g was much steeper,...
  • 13
  • 402
  • 0