rule begin each paragraph with a topic sentence end it in conformity with the beginning
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
Ngày tải lên :
28/03/2014, 14:20
... questioned variables The x2 test was used on the qualitative variables and the t-test on the quantitative variables From the total of the examined variables, the ones that presented a significant statistic ... was correlated with the choice of the sex of the doctor, since the women who had visited a gynecologist before they reached an average 20 years of age (19.71) preferred a man, with a significant ... Professionalism and courtesy come ahead as criteria, in relation to the doctor’s academic skills and his/her availability.1 The findings of this study allow us to conclude that parameters such as the...
- 9
- 432
- 0
a theory of virtue excellence in being for the good dec 2006
Ngày tải lên :
11/06/2014, 05:28
... this same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private ... faculty, but at least in part of an intellectual faculty They have an intentionality, and typically are constituted by a liking that is a way of being for an intended object Enjoying an intended ... engage the human being and the human being’s good in a decisively deeper and richer way than it can engage with another dog Hurka may have a counterargument against relying, as I do, on an openended...
- 264
- 227
- 0
Báo cáo hóa học: "Research Article Existence of Solutions for a Class of Elliptic Systems in RN Involving the p x , q x -Laplacia" pptx
Ngày tải lên :
22/06/2014, 03:20
... being intimately connected with the first eigenvalue of an appropriate system Using a weak version of the Palais-Smale condition, that is, Cerami condition, they apply the mountain pass theorem ... “Uniqueness of solutions of the parabolic variational inequality with variable exponent of nonlinearity,” Nonlinear Analysis: Theory, Methods & Applications In press 16 J Chabrowski and Y Fu, “Existence ... Euler-Lagrange functional of the system, the author limits himself to the subcritical case for function F to obtain the existence and multiplicity results In the paper 31 , Xu and An deal with the...
- 16
- 288
- 0
a study on politeness strategies in requests by the characters in the novel twilight by stephenie meyer = nghiên cứu chiến lược lịch sự trong lời thỉnh cầu của các nhân vật trong tiểu thuyết chạng vạng
Ngày tải lên :
02/03/2015, 14:22
... Edward gradually find themselves in love with each other They are now faced with the dangers inevitably intertwined with the existence of human blood drinking vampires, but finally overcome all ... occur in everyday life and play a leading role in human interaction as a vital part of successful communication Hence, many interlanguage and cross-cultural pragmatic studies within different language ... use and interpret a language appropriately and naturally in a particular situation Hence in language teaching, apart from linguistic competence, pragmatic competence should be addressed First, the...
- 62
- 807
- 1
A study on politeness strategies in requests by the characters in the novel “Twilight” by Stephenie Meyer
Ngày tải lên :
10/08/2015, 19:48
... for appropriateness in communication The teaching and learning of foreign languages, including English has shifted from linguistic forms of the target language to the communicative approach with ... social parameters (Brown and Levinson, 1987) Requests occur in everyday life and play a leading role in human interaction as a vital part of successful communication Hence, many interlanguage and ... Questioning the feasibility of the precondition for the act c Questioning the availability of the Hearer 2.4.4 Internal modification Internal modification includes syntactic downgraders, lexical/phrasal...
- 10
- 532
- 1
The research is a sure-fire solution to apply on realistic condition due to its feasibility and low cost for a development of sustainable agriculture in Vietnam as the top aims of Sony Green competition
Ngày tải lên :
15/01/2016, 16:17
... such as: Each brass basin has 10l (waste or pure water) with plants same size (35±2cm) Figure: Brass basin: waste concentration 100% with plants equation has brass basin: + Brass basin 1: waste ... chemical-physical index in waste water with Ludwigia + Investigate a growing capability of Ludwigia in waste water and pure water + Comparison and conclusion about Ludwigia’s impacts in waste treatment ... by time and growing capability Ludwigia in waste water Since then we can compare with different concentration, analyse data of study and conclude about the waste treatment of Ludwigia - Experiment...
- 16
- 518
- 0
Báo cáo khoa học: "A Generic Sentence Trimmer with CRFs" pot
Ngày tải lên :
31/03/2014, 00:20
... elements such as noun, case particle, but acts as a morphological atom, in that it cannot be torn apart, or partially deleted, without compromising the grammaticality.3 Noting that a Japanese sentence ... for relational learning In Lise Getoor and Ben Taskar, editors, Introduction to Statistical Relational Learning MIT Press To appear Charles Sutton, Khashayar Rohanimanesh, and Andrew McCallum ... marked NP in compression as its removal often leads to a decreased readability; and also it is grammatically wrong to start any compressed segment with sentence nominalizers such as We stand in...
- 9
- 169
- 0
101 ielts speaking part two topic cards that tie in with ielts speaking part one
Ngày tải lên :
04/10/2012, 11:45
... to Talk about a pet you have or have had You should mention: -Its appearance -Its personality -Its habits And say if you would like to have a similar pet again or not, and why Talk about a job ... are interested in that thing - If it is an easy or hard thing to start - What the best way to start doing it is And say if you think you will start doing it soon or not, and why Talk about a sport ... that means of transport - What the advantages of that method of travelling are - What the disadvantages are And say if you think you will use that means of transport more or less often in the...
- 25
- 2.7K
- 19
Báo cáo y học: "Two-year Outcome of Turkish Patients Treated with Zotarolimus Versus Paclitaxel Eluting Stents in an Unselected Population with Coronary Artery Disease in the Real World: A Prospective Non-randomized Registry in Southern Turk
Ngày tải lên :
25/10/2012, 11:18
... of these initial trials indicate that the ZES is safe and reduces the rates of clinical and angiographic restenosis in patients with symptomatic coronary artery disease (CAD; 4) Also the safety ... Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; ... that they considered to be best Study End Points and Definitions The primary clinical efficacy end points included major adverse cardiac events (MACE) at two year (MACE: Death, myocardial infarction,...
- 6
- 550
- 0
Báo cáo y học: "Efficacy of Sirolimus-Eluting Stents Compared With Paclitaxel-Eluting Stents in an Unselected Population With Coronary Artery Disease: 24-Month Outcomes of Patients in a Prospective Non-randomized Registry in Southern Turkey&
Ngày tải lên :
26/10/2012, 08:57
... coronary artery binding graft; CK: creatine kinase; MACE: major adverse cardiac events; MI: myocardial infarction; PES: paclitaxel-eluting stent; RESEARCH: Rapamycin-Eluting Stent Evaluated at ... myocardial infarction (MI), and target vessel revascularization (TVR) MI was defined as the elevation of creatine kinase (CK) > times above the upper limit of normal with any associated elevation ... outcomes compared with outcomes associated with SES treatment Also, in the multivariate analysis, after adjusting for clinical variables, we found that PES use was a predictor of MACE within 24 months...
- 6
- 627
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
Ngày tải lên :
26/10/2012, 10:04
... 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize part ... interlaced polymerase chain reaction Med Sci Monit 2001; 7: 345-9 14 Ogawa Y, Itoh H, Nakagawa O, et al Characterization of the 5'-flanking region and chromosomal assignment of the human brain ... repeat allele (Table 3) The plasma BNP level was significantly higher in the EH group than in the NT group (p=0.0203) The plasma BNP level in each genotype with or without the 16 repeat allele was...
- 7
- 612
- 1
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
Ngày tải lên :
03/11/2012, 11:52
... of interest exists References Renal Data System USRDS 2003 annual data report: atlas of end- stage renal disease in the United States Bethesda: National Institutes of Health, National Institute ... of the complex syndrome of malnutrition, inflammation and oxidative stress in patients with CKD In order to reduce cardiovascular mortality, nutritional, anti-inflammatory and antioxidant intervention ... viewed as a composite marker which reflects malnutrition as well as increased acute phase inflammation, considering that albumin is also a negative acute phase reactant (38, 42-45) Our study has...
- 5
- 723
- 0
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
Ngày tải lên :
07/11/2012, 15:06
... material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in the ... that as non- speakers, they not have enough insight into the other culture to teach it However, being a native speaker is not always an advantage, because in an intercultural approach, the teacher ... biggest headache for language teachers, especially the teacher of EFL, is how to integrate culture teaching into our language programs Comparing- Contrasting is an approach to teach language and culture...
- 40
- 644
- 1
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
Ngày tải lên :
05/09/2013, 10:17
... an approach of CO2 fixation In the microalgal cultivation system the microalgae grow with inorganic nutrients in wastewater as growth medium, and at the same time the nitrogen and phosphorus in ... content of organics and inorganic nutrients could be obtained, and also the microalgal biomass could be harvested for further application The clean water from the microalgae-separation unit could ... important in the microalgal cultivation unit of the novel process Harvest of microalgal biomass The microalgal biomass needs to be separated and harvested from the microalgal cultivation unit for...
- 9
- 762
- 0
INCORPORATING ENGLISH CULTURAL ELEMENTS INTO ENGLISH TRAINING WITH THE COMPARING CONTRASTING APPROACH a CASE OF TOURISM STUDE
Ngày tải lên :
07/09/2013, 13:41
... material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack of adequate training HCC teachers may not have been adequately trained in the ... that as non- speakers, they not have enough insight into the other culture to teach it However, being a native speaker is not always an advantage, because in an intercultural approach, the teacher ... biggest headache for language teachers, especially the teacher of EFL, is how to integrate culture teaching into our language programs Comparing- Contrasting is an approach to teach language and culture...
- 40
- 420
- 0
ANALOG BEHAVIORAL MODELING WITH THE VERILOG-A LANGUAGE- P9
Ngày tải lên :
18/10/2013, 00:15
... determines the operating point of the circuit with inductors shorted and capacitors opened An operating point analysis is specified using: OP In addition, an operating point analysis is performed automatically ... (+) in column on the following line Spice will continue reading beginning with column Name fields must begin with a letter [a z] and cannot contain any delimeters Names within Spice netlists are ... [w=value] [l=value] Where MNAME is the model name The model name is defined using a MODEL card, assigning parameters by appending the parameter name for the given model type with an equal sign and...
- 14
- 626
- 1
Write Better Essays - Choosing a Topic and Developing a Thesis
Ngày tải lên :
25/10/2013, 17:20
... system Topic turned into a question: How can we eliminate inequalities in the federal tax system? Tentative thesis: Instituting a flat tax will eliminate inequalities 45 – CHOOSING A TOPIC AND DEVELOPING ... Narrowed topic: Problems with the federal tax system Further narrowed topic: Inequalities in the federal tax system Sufficiently narrowed topic: How to eliminate inequalities in the federal tax ... examined within the essay structure Turning Your Topic into a Question A thesis is the main idea of an essay, and is a response to a topic In the previous example, the student narrowed her topic...
- 6
- 533
- 2