rotation about an axis parallel to a coordinate axis
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... mammalian hosts. These animals,
usually pigs, act as a transformer or converters; creating a
strain that can more readily infect humans. Pigs can be
infected with both avian and human influenza A ... an intestinal virus change to that of a
respiratory airborne-virus that is adapted to the
mammalian lung? Second, the viruses must adapt to
environmental changes, able to withstand temperate, ... infects mammalian hosts. These animals,
usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans. Therefore swine
can be infected with both avian and...
- 4
- 520
- 0
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên :
06/11/2012, 10:35
...
guides, and then produce an essay through answering a set of questions. Minor changes and
substitutions of blank space, punctuation marks, and capitalization are also added to expand an
outline ... learners to write a paragraph before they started writing an essay. It was
easier to start writing with a paragraph (topic sentence and supporting ones). An essay is a
combination of paragraphs. ... practice of English Language Teaching, Longman handbooks for
language teacher: Longman group, ltd.
15. Heaton, J. B.1989. Writing English test, Longman handbooks for language teacher:
Longman...
- 48
- 602
- 1
A study oF An alternative approach to teaching essay writing to TOEFL learners Minor Thesis
Ngày tải lên :
06/11/2012, 10:35
...
career preparation and increased knowledge. I think that these are the most common reasons.
The first reason will begin with career preparation. Many learners go to university or
college want ... in life and best advice. However, children need to learn from other sources.
WRITING PAPER
Name: Group A Paper: 02F6g
Task: 02 AD
Write:
It’s said that parents are always the best teachers but ... work hard to earn money
to pay their children’s fee at school. They buy their son or daughter with good food; make a good
house where their children can come back to. Also parents want to choose...
- 4
- 480
- 0
Phân tích các yếu tố ảnh hưởng đến động lực làm việc của nhân viên công ty cổ phần du lịch an giang
Ngày tải lên :
29/11/2012, 08:58
... Lịch An Giang theo Quyết định số 366/QĐ-UB-TC ngày 22/03/2001 c a Chủ tịch Ủy
Ban Nhân Dân tỉnh An Giang.
Theo xu hướng cổ phần hoá doanh nghiệp nhà nước, Ủy Ban Nhân Dân tỉnh An Giang
đã ra Quyết ... Tên tiếng Việt: Công Ty Cổ Phần Du Lịch An Giang.
- Tên tiếng Anh: An Giang Tourimex Joint Stock Company.
- Tên viết tắt: An Giang Tourimex.
- Biểu tượng c a công ty:
- Trụ sở chính: Số 17, đường ... Xuyên,
An Giang.
- Chi nhánh tại thành phố Hồ Chí Minh số 39 5A Tạ Quang Bửu, phường 5, Quận 8,
TP.Hồ Chí Minh
- Website: www.angiangtourimex.com.vn.
- Email: tourimex@hcm.fpt.vn; tourimexbr@vnn.vn.
-...
- 74
- 3.1K
- 25
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
Ngày tải lên :
13/04/2013, 10:29
... understand more how a company builds and manages its brand to
get the full benefit from that, a study into the case of LiOA brand at Nhat Linh Co. Ltd., an auto
voltage stabilizer (AVS)manufacturer ... strong
brand. To understand more how a company builds and manages its brand to get the full benefit
from it, a study into the case of the LiOA brand at Nhat Linh Co., Ltd., an auto voltage stabilizer ... recommendations for LiOA branding management and communication program will be made
to help the Company manage its brand better and to strengthen its LiOA brand name in the AVS
market.
Nearly two...
- 67
- 974
- 0
Tài liệu Creating an XML File That Shows Changes Made to a DataSet pptx
Ngày tải lên :
21/01/2014, 11:20
... You want to get the original values and see which rows were
added, edited, or deleted.
Solution
Create an XML DiffGram, which is a document that details the modifications made to a
DataSet. ... sample code contains two event handlers and a single method:
Form.Load
Sets up the sample by loading the Categories table from Northwind into a DataSet
and displays the DiffGram for the DataSet ...
</diffgr:diffgram>
Here are descriptions of the three DiffGram sections:
<DataInstanceName>
The DataInstanceName is the name of the DataSet or DataTable. This block
contains the current...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
Ngày tải lên :
16/02/2014, 09:20
... Forward (nt 1552–1585 PAI-2)
SJS260 AACTCACCAT
AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2)
SJS261 CTTTGTTA
AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2)
SJS262 AACTCACCAT
AGGAATGCATAAGCTTTAACAAAG ... 1491–1508 PAI-2)
SJS138 TACG
AGATCT
TAGCTACATTAAATAGGC Reverse (nt 1620–1603 PAI-2)
SJS172 GGGATCATGCCCA
AGCTTATTTTCCTTACT Forward (nt 1491–1520 PAI-2)
SJS173 AGTAAGGAAAATA
AGCTTGGGCATGATCCC Reverse ... elucidated a mammalian 5¢ -to3 ¢
ARE decay pathway that is localized to P-bodies via an
ARE interaction with tristetraprolin and BRF1 [41–44].
However, both 5¢ -to3 ¢ and 3¢ -to5 ¢ pathways can be
simultaneously...
- 14
- 635
- 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf
Ngày tải lên :
07/03/2014, 10:20
... not necessar-
ily mean that translation starts from a downstream
AUG, as predicted by genome and mRNA analysis,
but raises the possibility that the translated form may
have used a CUG start codon ... with an N-terminal leu-
cine amino acid. Our present study indicates that non-
AUG translation initiation may be operable more
often than anticipated. This may have a great impact
on the analysis ... translation products by MHC
class I molecules. Science 301 , 1367–1371.
14 Schwab SR, Shugart JA, Horng T, Malarkannan S &
Shastri N (2004) Unanticipated antigens: translation
initiation at...
- 11
- 469
- 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
Ngày tải lên :
23/03/2014, 13:20
... it. Thanks to the editors
Amey Kanse, Kartikey Pandey, Ankita Shashi, and the project co-ordinators,
Zainab Bagasrawala and Vishal Bodhwani for working with me on this book.
Whose Side Are You ... effort and
got me un-stuck many a times.
My sincere thanks to Vijay Anand, who provided me the courage to go ahead
and take this journey. Vijay is truly inspirational and one can learn a ton of ...
co-operating to clean their room. While working at Oracle, he went to IIM, Bangalore
to get executive management education in general management.
He is an avid reader and also writes a blog on management...
- 328
- 4.5K
- 0
How to make a three axis CNC machine cheaply and
Ngày tải lên :
18/04/2014, 09:07
... have to redo some parts, but thats ok. Thank you.
Stuart.Mcfarlan says:
Oct 2, 2008. 2:48 PM REPLY
Hey galaxyman;
If you pay special attention to ensuring the rails on all three axises are parallel, ... CNC.
http://www.instructables.com/id/How -to- Make -a- Three -Axis- CNC-Machine-Cheaply-and-/
Torito says:
Nov 4, 2008. 11:41 AM REPLY
Are the y axis rails round or square? I couldn't find that out
galaxyman7 says:
Nov ... thing, because I had to make many of the holes a bit bigger because of many errors on my part. My machine is pretty ghetto so far. I hope the x -axis
cart goes well too.
GandLBassman says:
Oct...
- 17
- 654
- 0
Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust
Ngày tải lên :
05/05/2014, 08:45
... of
Germany.
DOKE,
N,, A, V.
RAMIREZ,
and K.
TOMIYAMA,
1987: Systemic induction
of
resistance
in
potato planLs
agamst Phytophthora infestans
by
local treatment with hyphal wall components
... costs, low
environmental impact and a possible control of coffee pests.
Materials and Methods
Plant and fungal materials
Coffee plants [Coffea arabica L. cv. 'Mundo Novo') were grown from ... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi
determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes
nas folhas tratadas, bem...
- 12
- 421
- 0