role of ethics in handling a crisis situation
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf
... technical advance takeplace, primarily are those where a firm, or a national economy, is engaged in routine activities. Thus, each national system of innovation is rooted in a na-tional system of ... Onaverage the academic staff makes up about half of total staff. Funding of terti-ary education from the Ministry of Education and Research amounted to 16billion NOK in 2002. External financing ... institutioner om ingår i det regionala in- novationssystemet rimliga förutsättningar för sin verksamhet samt att skapaett system av incitament som belönar vissa typer av handlingar. 21sities have a strong...
- 180
- 596
- 1
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx
... & Vaux DL(2000) Identification of DIABLO, a mammalian proteinthat promotes apoptosis by binding to and antagonizingIAP proteins. Cell 102, 43–53.7 Suzuki Y, Imai Y, Nakayama H, Takahashi ... [19]. In mammalian apop-tosis, caspase-8 and caspase-9 are known to be associ-ated with the mitochondrial pathway. Active caspase-8induces the release of mitochondrial apoptosis factors, in a ... (A) Fractionation PCR. A partial fragment of the mitochond-rial large subunit ribosomal RNA (23S rRNA) was amplified by PCR,using fraction samples that contained equal amounts of protein.Lane,...
- 10
- 642
- 0
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx
... Migraine without aura Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis pain Carotidynia joint surface pain Retrodiscal palm Capsule pain Ligament ... Glandular, ocular, and auricular pain Pulpaf pain Visceral mucosal pain Periodontal pain Connective-tissue pain Ostealgia m6 periosteal pain jyjpaln — Neuropathic pain Physical ... through inflammation or rupture, resultina in Dain. 8 Primary Dental Evaluation Findings in the Teeth and Mucous Membrane The intraoral evaluation includes in particular: ã careful evaluation...
- 379
- 1,162
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... pictures are present during both learningand recall. A clinical example would be a health professionaltelling a patient or family caregiver how to treat a bed sorewhile viewing matching pictures and ... there are large numbers of people with lowliteracy skills as shown in Table 2 [8].Gazmararian et al. [9] reported, in a study of 3260enrollees in a national managed care organization in theUnited ... Fehrenbach SN, Ren J, Koplan JP. Health literacy amongmedicare enrollees in a managed care organization. JAMA 1999;281:545–51.[10] International Reading Association, Special Interest group on readingand...
- 18
- 919
- 0
THE SITUATION OF CHILDREN IN INDIA A PROFILE doc
... still falling.Children Living in UrbanSettingsThe process of urbanization in India is at a critical point of transition. India has a youngand rapidly growing population, a potentialdemographic ... note that several challengesrelated to infrastructure, capacities, massinformation and awareness, teacheravailability, training functional redressalmechanisms, and effective monitoring systemwill ... education,starting at age six years may be too late to layTable 5: Learning achievements (in per cent) among students of Class V in India - 2002-2003and 2006-2007Year of survey Mathematics Language...
- 112
- 361
- 0
Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt
... numberEnzymeADA Adenosine deaminase 3.5.4.4ADPRT Adenine phosphoribosyltransferase 2.4.2.7AK Adenosine kinase 2.7.1.20ALD1 Fructose-diphosphate aldolase 4.1.2.13AMPDA Adenosine monophosphatedeaminase3.5.4.6APK ... 5Â-monophosphateINO InosineK+PotassiumLACL-LactateMetAcc Methylated acceptorNa+SodiumNAD Nicotinamide adenine dinucleotideNADH Nicotinamide adenine dinucleotidereducedNADP Nicotinamide adenine ... absence of adenosine kinase, as long as adenine phosphoribosyltransferase (ADPR transferase, or ADPRT) is present.This is indicative of an alternative salvage pathway in human erythrocytes, and...
- 13
- 476
- 0
báo cáo hóa học:" Role of CA125 in predicting ovarian cancer survival - a review of the epidemiological literature" pptx
... mortalityrates of ovarian cancer, with the highest rates observed in Northern and Western Europe, notably Scandinavia, and in North America [4].Ovarian cancer is often asymptomatic in its early stagesand ... laparotomy redundant. Cancer 1996, 77:1122-1130.72. Mano A, Falcao A, Godinho I, Santos J, Leitao F, de Oliveira C, Cara-mona M: CA-125 AUC as a predictor for epithelial ovariancancer relapse. ... JM, Clarke-Pearson D, BurgerRA, Mannel RS, DeGeest K, Hartenbach EM, Baergen R: Phase IIItrial of carboplatin and paclitaxel compared with cisplatinand paclitaxel in patients with optimally...
- 20
- 508
- 0
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx
... study was to develop a culturally appropriate approach for obtaining assent fromchildren aged eight to 17 years to participate in paediatric HIV-related operational research in Kinshasa, DemocraticRepublic ... University of North Carolina at Chapel Hill, USA, 3School of Public Health, University of Kinshasa, Kinshasa, Democratic Republic of Congo, 4Department of Dental Ecology, University of North Carolina ... been informed of their HIV status.Additionally, at that time, very little was known in thesub-Saharan African context about what role, if any, chil-dren play in decision making on research participation,and...
- 10
- 372
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
... Hemoglobin 2005, 29:91-106. 15. Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP. HbVar database of human hemoglobin ... longer easily available in routine and even reference laboratories. Lichtman and colleagues have reported a mathematical formula which can be used to calculate P50 reliably [5]. Calculating P50 ... [15]. All these Hb variants are inherited in an autosomal dominant manner. High affinity Hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia. This leads...
- 5
- 418
- 0
Báo cáo y học: "Association of ITGAV supports a role of angiogenesis in rheumatoid arthritis Peter Ahnert and Holger Kirsten" pps
... in (disease sub-type-specific) meta-analyses.ITGAV is the latest example of a candidate gene that may berelevant to RA. Increased significance in the combinedsamples in the study of Jacq and ... Migliorini P,Balsa A, Westhovens R, Barrera P, Alves H, et al.: The ITGAVrs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study.Arthritis ... OR in the range 1.1 to 1.2, variants of PADI4 andCTLA4 confer a similar risk to that of the new ITGAV variant.Because confirmed associations account for only about 50% of RA genetics, more candidate...
- 2
- 465
- 0
Báo cáo y học: "A role of ygfZ in the Escherichia coli response to plumbagin challenge" pdf
... pQE-ygfZG22 7A PygfZG227AR GTCCGGTATAACAGGCTTTCTTAAAGPygfZC228AF CTTTAAGAAAGGGGCTTATACCGGACAAG pQE-ygfZC22 8A PygfZC228AR CTTGTCCGGTATAAGCCCCTTTCTTAAAGPygfZC228SF CTTTAAGAAAGGCTCGTATACCGGAC pQE-ygfZC228SPygfZC228SR ... GTCCGGTATACGAGCCTTTCTTAAAGPygfZC228MF CTTTAAGAAAGGCATGTATACCGGAC pQE-ygfZC228MPygfZC228MR GTCCGGTATACATGCCTTTCTTAAAGPygfZY229AF TAAGAAAGGCTGTGCTACCGGACAAG pQE-ygfZY22 9A PygfZY229AR CTTGTCCGGTAGCACAGCCTTTCTTAPygfZT230AF ... CCATGGCCGCAGTCCCTGCCCCAGACCC pQE-Rv_0811cPRv0811cR AGATCTCCGAATACCGCCGCGCAGCCGCPygfZK226AF CAGCTTTAAGGCCGGCTGTTATACCG pQE-ygfZK22 6A PygfZk226AR CGGTATAACAGCCGGCCTTAAAGCTGPygfZG227AF CTTTAAGAAAGCCTGTTATACCGGAC...
- 13
- 440
- 0
Báo cáo y học: "Role of vasopressin in the treatment of anaphylactic shock in a child undergoing surgery for congenital heart disease: a case report" docx
... of data, and anal-ysis of data. AP, SM, CG, OLS, VV and ER have beeninvolved in drafting the manuscript or revising it, and forcritical review of important intellectual content. SP gavefinal ... [3]. Cardiovascular collapse due to ana-phylaxis is a vasodilatory shock, characterized by anabrupt fall in systemic vascular resistance, enhanced vas-cular permeability, intravascular volume ... (NO) and the prostacyclinemediated vasodilating pathways [5]. Activation of induci-ble NO synthase (iNOS) is a major contributor to bothvasodilatation and resistance to the catecholamine vaso-pressor...
- 4
- 370
- 0
báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx
... -AGGATGGACAAACCCGTGAG-3’ and 5’-AAGC-CAGAGATGGGGACAAA-3’, and the amplicons have a predicted size of 232 bp and 202 bp, respectively. Foreach gene, a calibration curve was constructed by mea-suring ... 8(1):428.28. Davies C, Robinson SP: Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning andcharacterization of cDNAs encoding putative cell wall and ... 2004,55(1):45-59.65. Cho S, Jang S, Chae S, Chung KM, Moon YH, An G, Jang SK: Analysis of theC-terminal region of Arabidopsis thaliana APETALA1 as a transcriptionactivation domain. Plant Mol Biol 1999,...
- 19
- 389
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25