rice versus xanthomonas oryzae pv oryzae a unique pathosystem
Đánh giá tính kháng, nhiễm bệnh bạc lá (xanthomonas oryzae pv oryzae) trên một số dòng lúa triển vọng
... họ gen avrBs1 chỉ tìm thấy ở Xanthomonas campestis pv. campestris, còn họ gen avrBs3/pth xuất hiện phổ biến ở loài Xanthomonas oryzae pv. oryzae [21]. Ở loài Xanthomonas axonopodis pv. citri ... l a trồng và l a hoang. Mười một trong số ñó là gen lặn bao gồm: xa5, xa5(t), xa8, xa13, xa15, xa19, xa20, xa24, xa28, xa31 và xa32. Có 6 gen ñã ñược tách dòng là: Xa1, xa5, xa13, Xa21 Xa26 ... IRBB54 (xa5+Xa21); IRBB55 (xa13+Xa21); - Bốn dòng mang 3 gen kháng là: IRBB59 (xa5+xa13+Xa21); IRBB61 (Xa4+xa5+Xa7); IRBB62 (Xa4+Xa7+Xa21); IRBB63 (xa5+Xa7+xa13); - Hai dòng mang 4 gen kháng...
- 84
- 1,182
- 1
PHÂN LẬP VÀ NHẬN DIỆN VI KHUẨN GÂY BỆNH BẠC LÁ LÚA (XANTHOMONAS ORYZAE PV ORYZAE) BẰNG KỸ THUẬT PCR ĐA THÀNH PHẦN doc
... Keywords: Isolation, multiplex PCR, specific primer, Xanthomonas oryzae pv. oryzae Title: Isolation and identification of bacteria caught bacterial leaf blight (Xanthomonas oryzae pv. oryzae ) by ... Xanthomonas oryzae pv. oryzae. The pair of primers XO290R-F was designed to amplify a 290bp fragment based on rhs gene family of Xanthomonas oryzae pv. oryzae because these genes are structurally ... A THÀNH PHẦN Nguyễn Thị Liên1, Trần Thị Xuân Mai1 và Nguyễn Thị Pha1 ABTRACT Bacterial leaf blight of rice, caused by Xanthomonas oryzae pv. oryzae, is a harmful disease of rice plants...
- 10
- 1,122
- 4
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... possible combinations: (B ¼ b-Rha, A ¼ a- Rha, A ¼ a- Fuc3NAc (1fi2) a- Rha)B A, B– A B A A, B A A, B A A, B A A B A A A, B A A A, B A A A, B A A A, B A A A, B– A A A, B A A A, B A A A Several of these ... modelled were A A B A A B A A, A A B A A B A A, A A B A AvB A A and A A B– A A B A A (B: b-Rhap ,A: a-Rhap, A: a- Fucp3NAc(1fi2 )a- Rhap). The phi and psi angles aredefined by H1–C1–O1–CX and C1–O1–CX–HX, ... away towardsthe terminal end. The following fragments were assignable(the assigned a- Rha being bold):B A B A, B A B– A, B A A A, B A A A, B A A A/ B, A A A, A A B, A A B, B A B, B A A, B A A, ...
- 9
- 454
- 0
Tài liệu Báo cáo khoa học: Molecular and biochemical characterization ofD-phosphoglycerate dehydrogenase fromEntamoeba histolytica A unique enteric protozoan parasite that possesses both phosphorylated and nonphosphorylated serine metabolic pathways docx
... toan open reading frame (ORF) of EhPGDH was amplifiedby PCR using a cDNA library [26] as a template, andoligonucleotide primers (5¢-caGGATCCaagatagttgtgataaccga-3¢ and 5¢-caCTCGAGttagaacttattgacttggaa-3¢), ... protozoan parasite Entamoeba histolytica. Mol. Biochem.Parasitol. 97, 33–44.27. Nozaki, T., Asai, T., Sanchez, L.B., Kobayashi, S., Nakazawa, M.& Takeuchi, T. (1999) Characterization of ... methionine c-lyase from Entamoeba histolytica: a key enzyme ofsulfur-amino acid degradation in an anaerobic parasitic protistthat lacks forward and reverse transsulfuration pathways. J. Biol.Chem....
- 12
- 464
- 0
Tài liệu Báo cáo khoa học: A unique variant of streptococcal group O-antigen (C-polysaccharide) that lacks phosphocholine ppt
... clearly showed thatthe majority of the material constituted of a tetrasaccha-ride and a smaller amount of a tetrasaccharide-ribitol.The data shows that the AAT residue is indeed anacetamido-amino ... was clear that the oligosaccharidefraction was a mixture and that it was the same mixture asthat obtained from pneumococcal C-polysaccharide whentreated with aqueous 48% HF under same conditions. ... Thephosphoethanolamine and phosphate groups were absentas a result of that all phosphate ester linkages were broken.From the1H-NMR spectrum it was clear that the fractioncontained a major and a minor...
- 6
- 545
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCAReverse GCTAGGATCCCTAGCAACCACGGCACTable 2. Antifungal activity of WAMP- 1a. IC50is the concentrationnecessary for 50% growth inhibition.Fungi ... kiharae seeds with a unique 10-cysteine motifTatyana I. Odintsova1, Alexander A. Vassilevski2, Anna A. Slavokhotova1,Alexander K. Musolyamov2, Ekaterina I. Finkina2, Natalia V. Khadeeva1,...
- 10
- 505
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... ofcarotenoids.AbbreviationsCCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1,Oryza sativa carotenoid cleavage ... Dun EA, Pillot JP, Letisse F, Matusova R, DanounS, Portais JC et al. (2008) Strigolactone inhibition ofshoot branching. Nature 455, 189–194.11 Umehara M, Hanada A, Yoshida S, Akiyama K, AriteT, ... 3-OH-c-car-otene and lycopene. The values represent ratios of the C17and C19dialdehydes in the sum of their peak areas calculated by integratingeach peak at its individual kmax. Data represent...
- 12
- 497
- 0
Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt
... molecular mass of118 kDa and a pI of 4.85, displayed a multidomain organ-ization bearing a canonical family 48 catalytic domain, a bacterial type 3a cellulose-binding module, and a putativefibronectin-III ... cellulase among BacillalesMarta M. Sa´nchez, F. I. Javier Pastor and Pilar DiazDepartment of Microbiology, Faculty of Biology, University of Barcelona, SpainSequence analysis of a Paenibacillus ... domain. The cloned cellulase, unique amongBacillales and designated Cel48C, was purified through a nity chromatography using its ability to bind Avicel.Maximum activity was achieved at 45 °C and...
- 7
- 404
- 0
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot
... Cerebratulus californiensis and Cerebratuluslacteus. J Exp Zool 290, 431–436.16 Munoz-Guerra S, Azorin F, Casas MT, Marcet X,Maristany MA, Roca J & Subirana JA (1982) Structuralorganization ... Journal compilation ª 2006 FEBS A unique vertebrate histone H1-related protamine-likeprotein results in an unusual sperm chromatinorganizationNu´ria Saperas1, Manel Chiva2, M. Teresa Casas1, ... Polite`cnica de Catalunya, Barcelona, Spain2 Departament de Cie`ncies Fisiolo`giques II, Facultat de Medicina, Universitat de Barcelona, L’Hospitalet de Llobregat, Spain3 Departamento de...
- 14
- 484
- 0
Báo cáo khoa học: GRAIL: a unique mediator of CD4 T-lymphocyte unresponsiveness ppt
... inositolphosphate, calcium, and tyrosine kinase signalingpathways. Proc Natl Acad Sci USA 91, 38–42.44 Hundt M, Tabata H, Jeon MS, Hayashi K, Tanaka Y,Krishna R, De Giorgio L, Liu YC, Fukata M &Altman ... signaling, andultimately, mammalian target of rapamycin (mTOR)-dependent translation of select mRNA ([24] andunpublished data) (Fig. 3). In particular, IL-2R signal-ing leads to Akt and mTOR activation, ... indysregulated differentiation. Acta Haematol 122 , 230–237.64 Nakamichi S, Senga Y, Inoue H, Emi A, Matsuki Y,Watanabe E, Hiramatsu R, Ogawa W & Kasuga M(2009) Role of the E3 ubiquitin ligase...
- 12
- 337
- 0
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... withprotparam (http://www.expasy.org).Removal of the His-tag A factor Xa cleavage site was created between the lastamino acid (valine) and the His-tag. Cleavage by factor Xaoccurs after an arginine, ... Havukainen H, Haataja S, Kauko A, Pulliainen AT,Salminen A, Haikarainen T, Finne J & PapageorgiouAC (2008) Structural basis of the zinc- and terbium-mediated inhibition of ferroxidase activity ... at 25 °C in air-equilibrated 50 mmMops (pH 7.0). The software datlab 4.2, furnished by themanufacturers, was used for data acquisition and analysis.Analytical ultracentrifugationSedimentation...
- 15
- 293
- 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... was amplified by PCR from theplasmid pCY167 (Suzuki H & Yamada C, Unpublished),using forward primer 5¢-CATATGGATGAGTACAAACAAGTAGATG-3¢ and reverse primer 5¢-GGATCCTCGAGCTCATTTACGTTTTAAATTAATGCCGAT-3¢ ... 2433–2439.11 Wada K, Hiratake J, Irie M, Okada T, Yamada C,Kumagai H, Suzuki H & Fukuyama K (2008) Crystalstructures of Escherichia coli c-glutamyltranspeptidasein complex with azaserine and acivicin: ... metabolism, and its reaction intermediate.Proc Natl Acad Sci USA 103, 6471–6476.9 Boanca G, Sand A, Okada T, Suzuki H, Kumagai H,Fukuyama K & Barycki JJ (2007) Autoprocessing ofHelicobacter...
- 10
- 375
- 0
Báo cáo khoa học: A unique tetrameric structure of deer plasma haptoglobin – an evolutionary advantage in the Hp 2-2 phenotype with homogeneous structure pot
... reverse-transcribed and PCR-amplified using proofreading DNApolymerase (Invitrogen), forward primer 5¢-TTCCTGCAGTGGAAACCGGCAGTGAGGCCA-3¢ and reverseprimer 5¢-CGGAAAACCATCGCTAACAACTAAGCTTGGG-3¢. ... molecu-lar mass of the a- chain from a purified sample wasalso similar to that of human a2 (Fig. 4A) . Third,by putative amino acid sequence alignment, the deer a- chain contains a tandem repeat that ... Putative amino acid sequence analysis and divergence of mammal Hps. (A, B) Amino acid sequence alignment of the a- and b-chainsof human and deer. Variable regions are shaded in black. The cDNA...
- 13
- 527
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25