responding to a form field gaining focus with onfocus

Báo cáo y học: "An open pilot study of zonisamide augmentation in major depressive patients not responding to a low dose trial with duloxetine: preliminary results on tolerability and clinical effects" ppsx

Báo cáo y học: "An open pilot study of zonisamide augmentation in major depressive patients not responding to a low dose trial with duloxetine: preliminary results on tolerability and clinical effects" ppsx

Ngày tải lên : 09/08/2014, 01:21
... consideration of a partial pharmacodynamic overlap between lamotrigine and the latterly introduced zonisamide [14-16] (at least with regard to a common putative modulation of glutamate and monoamines), ... started taking duloxetine 60 mg/day once a day after being evaluated by means of the HAM-D, Hamilton Scale for Anxiety (HAM -A) [22], Young Mania Rating Scale (YMRS) [23] and the Arizona Sexual ... of the outcome ASEX = Arizona Sexual Experience Scale; HAM -A = Hamilton Anxiety Scale; HAM-D = Hamilton Depression Scale; YMRS = Young Mania Rating Scale examinations MB, GR, AE and SC helped...
  • 8
  • 560
  • 0
Tài liệu Storing XML to a Database Field doc

Tài liệu Storing XML to a Database Field doc

Ngày tải lên : 24/12/2013, 05:15
... demonstrates how to store XML data in a text field of a database table and subsequently read it into an XmlDocument using the LoadXml( ) method Standard database access techniques using a DataAdapter ... System.EventArgs e) { DataSet ds = new DataSet( ); // Fill the Categories table and add it to the DataSet SqlDataAdapter da = new SqlDataAdapter("SELECT TOP * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... // For a new row, add the row with the ID and XmlField dt.Rows.Add(new object[] {id, xmlDoc.InnerXml}); // Update the database using the DataAdapter da.Update(dt); } private void readButton_Click(object...
  • 5
  • 404
  • 0
Báo cáo hóa học: " Research Article The Existence of Positive Solution to a Nonlinear Fractional Differential Equation with Integral Boundary Conditions" potx

Báo cáo hóa học: " Research Article The Existence of Positive Solution to a Nonlinear Fractional Differential Equation with Integral Boundary Conditions" potx

Ngày tải lên : 21/06/2014, 05:20
... Fractional Dynamic Systems, Cambridge Academic, Cambridge, UK, 2009 V Lakshmikantham and A S Vatsala, “Basic theory of fractional differential equations,” Nonlinear Analysis Theory, Methods & Applications, ... specifically, in almost all literature related to fractional differential equations The readers who are unfamiliar with this area can consult for example 1–6 for details Definition 1.1 see The integral ... 1, pp 56–64, 2005 V Daftardar-Gejji and S Bhalekar, “Boundary value problems for multi-term fractional differential equations,” Journal of Mathematical Analysis and Applications, vol 345, no 2,...
  • 14
  • 430
  • 0
báo cáo hóa học:" Research Article Existence of Solutions to a Nonlocal Boundary Value Problem with Nonlinear Growth" pptx

báo cáo hóa học:" Research Article Existence of Solutions to a Nonlocal Boundary Value Problem with Nonlinear Growth" pptx

Ngày tải lên : 21/06/2014, 11:20
... them a problem at nonresonance Nonlocal boundary value problems were first considered by Bicadze and Samarski˘ ı and later by Il’pin and Moiseev 2, In a recent paper , Karakostas and Tsamatos ... References A V Bicadze and A A Samarski˘, “Some elementary generalizations of linear elliptic boundary value ı problems,” Doklady Akademii Nauk SSSR, vol 185, pp 739–740, 1969 V A Il’pin and E I ... differential equations with integral boundary conditions at resonance,” Journal of Mathematical Analysis and Applications, vol 353, no 1, pp 311–319, 2009 11 B Du and X Hu, A new continuation theorem...
  • 15
  • 274
  • 0
a cross-cultural study on american-vietnamses verbal expressions in offering a gift and responding to a gift offer = nghiên cứu giao thoa văn hóa việt - mỹ về cách sử dụng ngôn từ để tặng quà và nhận quà

a cross-cultural study on american-vietnamses verbal expressions in offering a gift and responding to a gift offer = nghiên cứu giao thoa văn hóa việt - mỹ về cách sử dụng ngôn từ để tặng quà và nhận quà

Ngày tải lên : 02/03/2015, 14:17
... we make a speech, we carry out an act A speech act is an act that a speaker performs when making an utterance, including the following: a general act (illocutionary act) that a speaker performs, ... same case, with the same conversational partner, the Americans and Vietnamese have employed various strategies: - American informants use the following strategies with: + all the informants (all ... informants is female The questionnaire was handed to equal number of informants within two age ranges (24-39, 40-61) Care was taken so that the informants in Vietnam matched with the American ones...
  • 67
  • 1.5K
  • 4
A cross – cultural study on american – vietnamese verbal expressions in offering a gift and responding to a gift offer

A cross – cultural study on american – vietnamese verbal expressions in offering a gift and responding to a gift offer

Ngày tải lên : 10/08/2015, 19:46
... limited to the verbal aspects of the act of offering gifts Nonverbal aspects of the act such as paralanguage, extra-language and the like are not investigated Conclusions will be based on the analysis ... happiness, good health and big success.” What was wrong in that situation? The American teacher was completely reasonable in his behavior and there was nothing grammatically wrong in the monitor’s ... into a really nice social manner- offering gifts and responding to gift offers from cross-cultural communication perspective As a result of that, to seek a proper answer of what and how to say to...
  • 7
  • 1.2K
  • 21
Game changer how companies are responding to a fast changing business environment

Game changer how companies are responding to a fast changing business environment

Ngày tải lên : 06/12/2015, 23:07
... ability to respond to and drive change also forms part of executives’ performance management criteria “Change is core to how we evaluate people,” confirms Mr Tyagarajan “Every manager appraises ... boundaries 36% Decentralised decision-making 33% Accurate and up -to- date data 29% Ability to shift resources quickl;y 12 navigating to a new reality Adapting to change requires strong leadership According ... changing faster and faster, it means you have to make more calls and start experimenting You need to fail fast, fail quickly, and fail cheaply Rolf Bixner, Senior partner and managing director,...
  • 18
  • 214
  • 0
Báo cáo khoa học: "Unresectable gastric cancer with gastric outlet obstruction and distant metastasis responding to intraperitoneal and folfox chemotherapy after palliative laparoscopic gastrojejunostomy: report of a case" pdf

Báo cáo khoa học: "Unresectable gastric cancer with gastric outlet obstruction and distant metastasis responding to intraperitoneal and folfox chemotherapy after palliative laparoscopic gastrojejunostomy: report of a case" pdf

Ngày tải lên : 09/08/2014, 03:23
... Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, et al: S-1 plus cisplatin versus S-1 alone for first-line treatment of advanced gastric cancer ... http://www.wjso.com/content/8/1/109 treatment for peritoneal dissemination has been limited to patients with peritoneal carcinomatosis alone, rather than hematogenous metastasis, such as hepatic metastasis or distant lymph ... firstline therapy with locally advanced and metastatic gastric cancer or second-line treatment in advanced or metastatic gastric cancer patients, and may be considered a viable treatment alternative...
  • 4
  • 321
  • 0
Báo cáo khoa học: "Simultaneous in-field boost for patients with 1 to 4 brain metastasis/es treated with volumetric modulated arc therapy: a prospective study on quality-of-life" potx

Báo cáo khoa học: "Simultaneous in-field boost for patients with 1 to 4 brain metastasis/es treated with volumetric modulated arc therapy: a prospective study on quality-of-life" potx

Ngày tải lên : 09/08/2014, 09:20
... 71(1):64-70 Casanova N, Mazouni Z, Bieri S, Combescure C, Pica A, Weber DC: Whole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: ... not perform a multivariate analysis as the number of events relative to the potential parameters was inappropriate, these data suggest that dose escalation only with a SIB technique may not be ... al: Simultaneous infield boost with helical tomotherapy for patients with to brain metastases American journal of clinical oncology 2007, 30(1):38-44 28 Lagerwaard FJ, van der Hoorn EA, Verbakel...
  • 8
  • 392
  • 0
Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

Báo cáo y học: " Abnormal macrophage response to microbial stimulus in a 43-year-old man with a severe form of atherosclerosis: a case report" pptx

Ngày tải lên : 11/08/2014, 12:20
... Ethical reasons also dissuaded us from performing a coronary angiograph His family history for cardiovascular events was negative A brain MRI revealed mild cortical atrophy with bilateral lacunar ischemic ... Trasfusionale, Azienda Ospedaliera Brotzu, Cagliari, for preparing the buffy coats The study was funded by Fondazione Banco di Sardegna, Regione Autonoma della Sardegna and Nutrisearch Srl (Italy) Author ... http://www.jmedicalcasereports.com/content/4/1/183 Additional material Additional file 1: Materials and methods The data provided discuss the materials and methods used in plasma preparation, clinical chemistry,...
  • 5
  • 409
  • 0
Báo cáo y học: "Systemic sarcoidosis with bone marrow involvement responding to therapy with adalimumab: a case report" pot

Báo cáo y học: "Systemic sarcoidosis with bone marrow involvement responding to therapy with adalimumab: a case report" pot

Ngày tải lên : 11/08/2014, 14:20
... of adalimumab in a patient with systemic sarcoidosis with bone marrow involvement TNF antagonism with adalimumab was efficacious and well-tolerated in this patient and may be considered as a treatment ... considered tentative until additional cases and randomized controlled trials are performed to evaluate efficacy, safety, and appropriate dosing of adalimumab in patients with sarcoidosis Abbreviations ... Lovell D, Panaccione R, Perez J, Pangan AL: Adalimumab safety and mortality rates from global clinical trials of six immunemediated inflammatory diseases Ann Rheum Dis 2009; Jan 15 [Epub ahead of...
  • 4
  • 459
  • 0
 Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

Ngày tải lên : 25/10/2012, 11:40
... solution was deeply coloured and maintained for h at room temperature Then the organic phase was washed with water, followed by 1N HCl and again water The organic layer was dried over Na2SO4 and evaporated ... including breast cancer, and therefore became considered as a prognostic factor in breast cancer [21] It was also documented that peptide ligands containing RGD amino acid sequences have a high affinity ... surface, a feasible site of pharmacological action, allow expecting lower application doses with concomitantly decreased side-effects The uptake and internalization into the cells cytoplasm is...
  • 14
  • 480
  • 0
A study of responding to dispraise in english and vietnamese

A study of responding to dispraise in english and vietnamese

Ngày tải lên : 26/11/2013, 13:21
... non-verbal aspects, paralinguistic and extralinguistic factors master cross-cultural pragmatics as a whole A teacher may select any activity applicable to his/her classroom (See Appendix) To conclude, ... interaction state that, under normal circumstances, all individuals are motivated They assume that all competent adult members of a society have (and to avoid conveying FTA and are motivated to minimize ... that is socially and culturally receives a dispraise as a sensible dispraising expression, it may sound appropriate As a preliminary study to understand the socio-cultural like advisable, sympathetic...
  • 13
  • 714
  • 2
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

Ngày tải lên : 27/12/2013, 20:26
... attractive and more interesting and make pupils more motivated Eliciting questions are also a mean to check up and to give teachersnecessaryinformation such as: which parts pupils have already ... students to learn language The situation supplies them necessary information to carry out activities Teachers can ask questions and use some pictures to set language situation For example: Look at ... to help pupils understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar...
  • 42
  • 641
  • 0
A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

Ngày tải lên : 29/01/2014, 10:33
... learners need Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this aim was thought to ... need to understand what they are going to talk and also to master some particular grammar points and language skills The procedures that learners have to undergo to make themselves orally understood ... knows a foreign language can speak that language Pattison (1992) confirms that when a person speaks of knowing or learning a language they mean being able to speak the language Oral communication...
  • 44
  • 1.5K
  • 1
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx

Ngày tải lên : 18/02/2014, 13:20
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... Biol 24, 701–713 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic acid interactions (ProNIT) Bioinformatics 17, 1027–1034 ... from amino acid sequence data Anal Biochem 182, 319–326 Liu Q, Kasuga M, Sakuma Y, Abe H, Setsuko M, Yamaguchi-Shinozaki K & Shinozaki K (1998) Two transcription factors, DREB1 and DREB2, with an...
  • 10
  • 464
  • 1
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

Ngày tải lên : 19/02/2014, 16:20
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
  • 10
  • 488
  • 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Ngày tải lên : 21/02/2014, 03:20
... first pair was X289 (5¢ TgTgCTACTTgCC CTggAA 3¢) and X191 The second pair was X133 (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT 3¢) The PCR products were fractionated ... the two toxins appear to behave as comparable weak antagonists of neuronal a7 receptors Do cobra Wntxs and the potent a- neurotoxins bind to muscular AChRs using similar determinants? To address ... muscular-type AChRs [10–12,29,56,] Thus, using preparations of AChR from Torpedo californica, a weak neurotoxin from Naja kaouthia (WTX) was found to inhibit binding of radioactive a- bungarotoxin with...
  • 10
  • 395
  • 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Ngày tải lên : 06/03/2014, 08:21
... Galois Although we will use certain ad hoc tools, the central idea will always be to count fields by counting integral points on certain associated varieties, which are related to the invariant ... over Q with no proper subfields; one can formulate similar ideas in the general case Let L be such a number field Then OL is a lattice endowed with a natural quadratic form, namely x → tr(x2 ); as ... supported by NSA Young Investigator Grant MDA90502-1-0097 The second author was partially supported by NSF Grant DMS-0245606 724 JORDAN S ELLENBERG AND AKSHAY VENKATESH quadratic extensions of a fixed...
  • 20
  • 478
  • 0
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx

Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx

Ngày tải lên : 17/03/2014, 01:20
... forms as the training/evaluation data The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 ... problem, as compared to the generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm ... (2003), SaRAD (Adar, 2004), ALICE (Ao and Takagi, 2005), Chang and Sch¨ tze’s u method (CS) (Chang and Sch¨ tze, 2006), Nadeau u and Turney’s method (NT) (Nadeau and Turney, 2005), and Okazaki et al.’s...
  • 9
  • 389
  • 0