reading these sentences as a model asking sts to pay attention to strong form and weak form of these prepositions
Silicon as a model ion trap: Time domain measurements of donor Rydberg states
Ngày tải lên :
16/03/2014, 15:30
... atoms in traps, although phonon, rather than photon emission leads to decay time scales 10 –100 times faster than what is usual in atoms Our timedomain data show directly that population decay ... 58(19):12908 –12915 19 Halsall MP, Harrison P, Wells J-PR, Bradley IV, Pellemans H (2001) Picosecond farinfrared studies of intra-acceptor dynamics in bulk GaAs and ␦-doped AlAs/GaAs quantum wells Phys ... nx is unaffected by recombination of free electrons and ions in ˙ the case that Pg Ϸ Px, even if fast In the case of asymmetric recombination, a fast initial transient is expected, whereas the...
- 5
- 296
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
Ngày tải lên :
22/03/2014, 17:20
... hematopoietic compartment using a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral ... identified a number of transcriptional factors that are key regulators of HSC development For instance, the stem cell leukemia factor Scl, has been shown to play a pivotal role in endothelial and hematopoietic ... of diseases before clinical medical application can become a reality Ontogeny of human hematopoiesis Hematopoietic ontogeny has been the subject of intensive investigation by several groups As...
- 12
- 550
- 0
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
Ngày tải lên :
24/03/2014, 00:21
... Fluorescences of BIPM (A and B) and FITC (C and D) were measured with K+-activated phosphatase (A and C) and Na+-dependent ATPase (B and D) under pressures at 37 °C (d) The BIPM ¯uorescence was detected at ... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... EDTA in a total volume of mL The reaction was initiated by the addition of lg enzyme + Three activities of Na /K -ATPase were determined as follows Na+/K+-ATPase activity was measured by monitoring...
- 9
- 432
- 0
Báo cáo sinh học: "An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" pptx
Ngày tải lên :
18/06/2014, 19:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... percubator [12,13] And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program ... intramural program is often close to impermeable In contrast, universities and many research institutions contain a semi-permeable barrier that allows academic investigators to work in both arenas,...
- 4
- 395
- 0
báo cáo hóa học:" An NIH intramural percubator as a model of academic-industry partnerships: from the beginning of life through the valley of death" ppt
Ngày tải lên :
20/06/2014, 03:20
... scenario may be an important feature of the percubator, particularly in light of today’s usual translational approach: a) academia hands off an application to the private sector only if and when ... percubator [12,13] And as a practical matter, designating percubator investigators and their companies as ‘contractors and contract companies’ would be a simple route to initiating a pilot program ... intramural program is often close to impermeable In contrast, universities and many research institutions contain a semi-permeable barrier that allows academic investigators to work in both arenas,...
- 4
- 417
- 0
Cell Membrane: The Red Blood Cell as a Model ppt
Ngày tải lên :
29/06/2014, 11:20
... Yamada, Atsushi Togawa, Shunsuke Koresawa, Sumire Hasegawa, Yoshinobu Takemoto, Masahiro Yoshimoto, Kazuyuki Mitani, Kosuke Miyashima, Masakiyo Mannoji, Takashi Sugihara, Nobumasa Inoue, Masaoo Shimoda, ... Mika Takahashi, Mayumi Kaku, Masami Uno (Takezono), Kenichiro Yata, Hidekazu Nakanishi, Yoshimasa Suetsugu, Makoto Mikami, Takayuki Tsujioka, and Shinichiro Suemori, Ms Mayumi Aizawa (Takahara), ... Binding to Hemoglobin by the Cytoplasmic Domain of Band 84 Anion Exchange Channel by the Transmembrane Domain of Band 84 Lateral and Rotational Mobility of Band 85 Blood Type Antigens and Band 85 Band...
- 449
- 819
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
Ngày tải lên :
09/08/2014, 18:21
... composed of around 80 chromosomes separated into two classes: a few distinguishable macrochromosomes and a much higher number of small microchromosomes, visualized as dots on metaphase preparations and ... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the ... RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian Karyotype, concerns eight pairs of macrochromosomes and sex chromosomes Z and W (ICSAK,...
- 11
- 318
- 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
Ngày tải lên :
09/08/2014, 23:20
... mark the end of the data collection phase and the start of assembly and analysis The end of this phase will be marked clearly on the snake genomics website [21], as will milestones of data analysis ... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... genome that contains genic and near-genic regions that are assembled and annotated To provide a service to the broader research community, we have released a prepublication preliminary draft assembly...
- 8
- 410
- 0
Báo cáo khoa học: "Tumor slices as a model to evaluate doxorubicin in vitro treatment and expression of trios of genes PRSS11, MTSS1, CLPTM1 and PRSS11, MTSS1, SMYD2 in canine mammary gland cancer" pptx
Ngày tải lên :
12/08/2014, 18:22
... chemotherapy for breast cancer is associated with the same survival benefit as adjuvant chemotherapy and offers the advantage of an increased likelihood of breast conservation Many drug regimens have ... treatment (Figure 2) TGCTTTCGGAGCGTATATC CCATGTTCAGGGTGTTCTCC GACTCCCTTCAGTGCTCCAG CCGGTAAGACTGGCTGATGT TGAGGGCCTTGTAAGTGAGC CACAAGGGCTGGTACTCCTG GCTTGTACATGCAGGACTGG CCGTGAGCCACTTCCATTAT GGGTCATCATCTCTGCTCCT ... 50:78-83 Barbosa EM, Nonogaki S, Katayama MLH, Folgueira MAAK, Alves VA, Brentani MM: Vitamin D3 modulation of plasminogen activator inhibitor type-1 in human breast carcinomas under organ culture...
- 9
- 337
- 0
Báo cáo khoa học: " Bench-to-bedside review: Endotoxin tolerance as a model of leukocyte reprogramming in sepsis" pot
Ngày tải lên :
13/08/2014, 03:20
... Mashima R, Saeki K, Aki D, Minoda Y, Takaki H, Sanada T, Kobayashi T, Aburatani H, Yamanashi Y, Yoshimura A: FLN29, a novel interferon- and LPS-inducible gene acting as a negative regulator of ... phosphatase 1; Erk, extracellular signal-related kinase; HO-1, heme oxygenase-1; IB, inhibitor of B; IRAK, IL-1 receptor associated kinase; MAPK, mitogen-activated protein kinase; MKP, MAPK phosphatase; ... Net inflammatory capacity of human septic shock plasma evaluated by a monocyte-based target cell assay: identification of interleukin-10 as a major functional deactivator of human monocytes J Exp...
- 8
- 210
- 0
Báo cáo y học: "Vasculature deprivation – induced osteonecrosis of the rat femoral head as a model for therapeutic trials" ppsx
Ngày tải lên :
13/08/2014, 23:20
... tissue and lastly bony beams replace the dead cartilage [9] about the 3rd postoperative month is that of osteoarthritis portraying distorted anatomical landmarks due to inappropriate repair of the ... epiphyseal hard and soft tissues and articular cartilage [19], matching Sokoloff's concept of degenerative joint disease as a deranged tricompartmental articulation [23] The articular aspect demonstrates ... for granted the accuracy of the paradigm of the pathogenetic role of vascular deprivation and anoxia in bringing about necrosis of the femoral head, revascularization and oxygenation ought to be...
- 14
- 357
- 0
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
Ngày tải lên :
14/08/2014, 16:21
... sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) and an MS/MS tolerance at 0.5 Da and either full ... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... growth, SILAC labeling and extract preparation Yeast cell culture and harvesting was done as close as possible to the protocol of Ghaemmaghami et al [17], in order to make results comparable Wild-type...
- 15
- 267
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
Ngày tải lên :
15/05/2015, 00:37
... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the ... decreased as they adapted to darkness The habituation effect can also be seen as the decrease of active time toward the end of the dark phases, though the point of reaching maximal activity varied ... and mbpa), and vascularisation (vegfr2) Alterations in gene expression are displayed on a logarithmic scale to show both increase (positive values) as well as decrease (negative values) of each...
- 58
- 262
- 0
The roles of rac1 and syncollin in regulated exocytosis insulin secreting INS 1 cells as a model
Ngày tải lên :
16/09/2015, 17:11
... characterized responses to Rho GTPases in mammalian cells link the plasma membrane receptors to the assembly and organization of the filamentous actin cytoskeleton Rac regulates the formation of ... require active actin polymerization at the plasma membrane A number of Rac effectors act as regulators of actin polymerization The p21activated kinase (PAK) that is activated by binding to active Rac ... Shirsat et al., 1990) Different mammalian Rho GTPases are at least 40% identical to each other at the amino-acid level, whereas they are approximately 25% identical to Ras To date, only Rho, Rac,...
- 140
- 249
- 0
Báo cáo khoa học: Trypanosoma brucei: a model micro-organism to study eukaryotic phospholipid biosynthesis docx
Ngày tải lên :
28/03/2014, 23:20
... essential nature of the Kennedy pathway was also demonstrated in Plasmodium berghei blood stage parasites [67] Analysis of the phospholipid composition of T brucei parasites after RNAi against ethanolamine ... all kinetoplastid CTs are unusual fusion proteins in having a cytidylyltransferase domain fused to a CDP-alcohol phosphatidyltransferase domain that is normally found in CEPT and CDP-ethanolamine:diacylglycerol ... in a mutant strain of Saccharomyces cerevisiae by the AUR1 gene J Biol Chem 272, 9809–9817 Kuroda M, Hashida-Okado T, Yasumoto R, Gomi K, Kato I & Takesako K (1999) An aureobasidin A resistance...
- 12
- 391
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
Ngày tải lên :
18/06/2014, 19:20
... manuscript and read and approved the final manuscript Additional material Additional file Analysis of covariance of each subscale of SF-36 (n = 227) with respect to SOC adjusted for sex, age group, marital ... providing health care information and health care in a consistent way Manageability could be enhanced by having family and health care professionals provide resources such as social support [51] Health ... general linear model procedure of SPSS for Windows (version 14.0) We coded sex, age group, marital status and education as categorical variables and used SOC and comorbidity as continuous covariates...
- 9
- 844
- 0
Báo cáo khoa học nông nghiệp " Nutrient recovery by rice crops as a treatment for aquaculture solid waste: crop yield, nutrient status and nutrient budgets " doc
Ngày tải lên :
21/06/2014, 04:20
... waste was applied before planting as was 50 % of the inorganic P and K The remaining P and K was applied at panicle initiation stage at 35 days after sowing (DAS) while N was split times (7, 20 and ... (Page et al 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) EPA/600/4/79-020 revised March ... Statistical analysis was completed with IRRISTAT software version 5.1 by applying a balanced one-way ANOVA Nutrient (N, P, K) balances were calculated following the approach of Dobermann and Fairhurst...
- 24
- 345
- 0
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot
Ngày tải lên :
22/06/2014, 23:20
... stationary band-selective noise The noise was additive, and simulated by passing Gaussian white noise through a band-pass filter The central frequency and bandwidth of the noise were varied to ... generated, including three cases with one subband corruption (a ecting subbands 2, 3, and 4, resp.), three cases with two subband corruption (a ecting subbands and 3, and 4, and and 5, resp.), and ... removal) and with the addition of the delta vector, was used in the experiments Thus, there was a feature vector of twelve streams, six static and six dynamic, for each frame This frame vector was...
- 12
- 323
- 0
Báo cáo hóa học: "Research Article A Model-Based Approach to Constructing Music Similarity Functions" potx
Ngày tải lên :
22/06/2014, 23:20
... variation of the features The sequence of mean and variance vectors is used to train the classification models The Marsyas [16] software package, a free software framework for the rapid deployment and ... discriminant analysis (LDA) and a classification and regression tree (CART) of the type proposed by West and Cox in [15] and West [18], which performs a multiclass linear discriminant analysis and ... contrast, the CART-based model returns a leaf node in the tree for each vector and the final degree of support is calculated as the percentage of training vectors from each class that reached that...
- 10
- 361
- 0
Báo cáo lâm nghiệp: "Multifunctional forestry practices as a land use strategy to meet increasing private and public demands in modern societies" ppt
Ngày tải lên :
07/08/2014, 03:22
... area for leisure and relaxation Inhabitants of mountain regions see it as protection against natural dangers and as a tourist attraction Forest owners, farmers, and industry see it primarily as ... regulated forest uses in accordance with the demands and options of their times (Mantel 1990) As early as in 1295, a local rule of Landau (Palatina) provided that wood cut in the area be available ... potential as well as the specificity of the landscape The traces of earlier settlements and abandoned farms reveal the dynamics of needs and values that determined the actual distribution of forests...
- 9
- 391
- 0