qualities professional capacity work ability by adding a check mark x in the appropriate box corresponding to each level of your choice for all the item bellow
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for managers—that of finding a reliable source of information and keeping an adequate ... would have Thanks to my teams, past and present; to my managers in the past and present; to the organizations I worked for, and to my teachers in academics and in sports for teaching me all that ... becoming more important as the amount of information and the mode of information have changed and has been changing rapidly since the Internet became part of the corporate world In the Indian context,...
- 328
- 4,476
- 0
Báo cáo y học: " Respiratory difficulty caused by an ectopic brain tissue mass in the neck of a two-month-old baby: a case report" ppsx
... sincere gratitude to all the Pediatric Surgery Unit staff at the Maternity And Child Teaching Hospital, Al-Qadisiya, Iraq, for their assistance Thanks also go to Dr Luaay E Alkhury (pathologist), ... heterogeneous mass extending from the base of the skull to the left submandibular region; a cystic component was also noted Findings from a CT scan of the brain were normal The initial diagnosis was cystic ... performed the histopathological examination of the mass The author read and approved the final manuscript 17 18 Hendrikson M, Faye-Petersen O, Johnson DG: Cystic and solid heterotopic brain in the...
- 3
- 347
- 0
Báo cáo y học: " WT1 PEPTIDE VACCINATION IN COMBINATION WITH IMATINIB THERAPY FOR A PATIENT WITH CML IN THE CHRONIC PHASE"
... 40 6a 27 Oka Y, Tsuboi A, Murakami M, Hirai M, Tominaga N, Nakajima H, Elisseeva OA, Masuda T, Nakano A, Kawakami M, Oji Y, Ikegame K, Hosen N, Udaka K, Yasukawa M, Ogawa H, Kawase I, Sugiyama ... was bl locked rema arkably by adding CFSE-u unlabeled tar rget cells in a cold inhibit tion test The cy ytotoxic abilit of MLPC cells was blo ty ocked remarkab by adding antibodies a bly g against ... the 8th administration of WT1 peptides Referring to a report that the tetramer binding capacity and specific cytotoxicity of the CTL line decreases remarkably by the stimulation of relevant peptide-pulsed...
- 10
- 739
- 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that finally leads to the supercomplex formation ... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... immediately after the addition of the ISP to the bc1 sub-complex, a shift in the molecular mass from approximately 500 to 670 kDa occurs This change in the molecular mass is too large to be explained by...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... levels of identity to sequences of 2-aminomuconate deaminases [6,8,27] or to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the ... enzyme activity In contrast, the deaminase from strain 10d contained an FAD-like cofactor, similar to D-amino acid oxidases [25–27], as indicated by the absorption peak of the purified enzyme at 266 ... nm The typical protein absorption peak of 280 nm shifts to 265 nm if the protein contains a flavin-type cofactor [28] We failed to identify the cofactor of the deaminase from strain 10d because...
- 7
- 613
- 1
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
... amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the opistoporins ... Gramnegative and Gram-positive bacteria and their activity was compared with the activity of melittin and mastoparan (Table 1) Parabutoporin inhibits the growth of all Gram-negative bacteria ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria...
- 12
- 598
- 0
Tài liệu Báo cáo Y học: Granule-bound starch synthase I A major enzyme involved in the biogenesis of B-crystallites in starch granules ppt
... After the last wash, the starch pellet was stored at °C awaiting further analysis Separation of starch polysaccharides by gel permeation chromatography In vitro assay of GBSSI activity This assay ... followed the kinetics of amylose synthesis over a 5-day period of nitrogen starvation and measured the amounts of starch, amylose, the kmax of the starch fractions, the degree of crystallinity and the ... PA55 and the SA137C antibodies to screen for expression of corresponding epitopes within a k ZAP II cDNA library From a total of 25, we found one and four phage plaques reacting against PA55 and...
- 11
- 556
- 0
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
... in the 2 -to- 1 way onto the domain A (so that there is a critical point of g in the central domain), • All other components of B are mapped univalently onto A by the map g, • The iterates of the ... F0 (x) ∈ Ac Ac x B0 AXIOM A MAPS 27 Denote the first return map of the map F0 to the domain Ac by R0 and ˆ Ac by A0 It is easy to see that R0 is a holomorphic box mapping and that ˆ ˆ x the ... component of the domain B Then the ratio |Akl +1 | |Akl | tends to exponentially fast, where |Ak | is the length of the real trace of the domain Ak Here the real trace of the domain is just the intersection...
- 44
- 412
- 0
Đề tài " On a vanishing conjecture appearing in the geometric Langlands correspondence " pptx
... sheaves The { exactness } → { vanishing } implication is achieved by an argument involving the comparison of Euler-Poincar´ characteristics of complexes obtained by e d applying the functor AvE ... that it is indeed sufficient to show that the functor Av1 E is exact: The exactness of Av1 implies that the functor ItAvd is exact for any E E d Since the coefficients of our sheaves are of characteristic ... consist of making the Hecke functors exact by passing to a quotient triangulated category Recall that if C is a triangulated category, and C ⊂ C is a full triangulated subcategory, one can form a quotient...
- 67
- 377
- 0
TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot
... on the probability of increasing savings, and the probability of increasing savings by at least 20 percent This enables a substantial increase in savings by a wealthy individual to be muted in ... P-value A VARIABLES AVAILABLE AT TIME OF RANDOMIZATION Client savings balance (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard deviation of balances in ... reached by the survey team and in the “Treatment” group were approached via a door -to- door marketing campaign to open a SEED account Individuals reached by the survey team and in the “Marketing”...
- 38
- 523
- 0
Báo cáo khoa học: Structural characterization of a novel branching pattern in the lipopolysaccharide from nontypeable Haemophilus influenzae pot
... (data not shown) The structures of the other Hep3-glycoforms were obtained in an analogous manner (data not shown) and for all glycoforms the hexoses were found to be members of a linear chain ... various alditol acetates and partially methylated alditol acetates obtained in sugar- and methylation analyses correspond to the detector response of the GLC-MS Permethylation of dephosphorylated ... HepIII (data not shown); the exact location is a matter for further investigation The low abundance of the sialylated glycoforms prevented the determination, by NMR, of the location of Neu5Ac Precursor...
- 13
- 433
- 0
Once Upon A Time in the Italian West: The Filmgoers' Guide to Spaghetti Westerns
... and Hank) stand face to face in the main street of Quemado They walk towards each other, but instead of drawing, they shake hands and wish each other ‘Happy Christmas’ The Christmas setting also ... in this Roman ‘west’ Familiar locations include a gorge at Tolfa, the quarries at Magliana, the landscape of Manziana around Bracciano Lake, the Abruzzo National Park and the Nature Reserve at ... wasn’t a bad salary for standing, squinting into the sun in Spain Even so, the fact that he was the cheapest actor available for the role wasn’t lost on Eastwood – especially when Leone had the...
- 289
- 603
- 0
Considering the Creation of a Domestic Intelligence Agency in the United States pot
... Australian intelligence community ANAO Australian National Audit Office AQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic Maghreb] ASALA Armenian Secret Army for the Liberation of Armenia ... literature examines how data and information are collected, analyzed, and applied by the private sector to build or defend competitive advantage in the market 4 Considering the Creation of a Domestic ... security agencies tasked with garnering information on the activities of Imperial Japan in the Asia-Pacific This legislation specifically designates ASIO as Australia’s principal national agency...
- 218
- 375
- 0
BAMBOO AS A NEW FIBER SOURCE IN THE US PAPER INDUSTRY: A FEASIBILITY ANALYSIS FOR BOOSHOOT GARDENS, LLC docx
... of paper at a faster rate An example of this is described by author Nancy Ohanian in Spain: "about 1150, papermakers in Xatina, Spain, began to use water power to beat the rags They extended the ... read a piece of my thesis and tell me what they thought I handed them pages Today, I can explain paper manufacturing to anyone because I had the chance to talk about my work and discuss my findings ... sanitary paper industry, a small niche in the larger U.S paper industry Based on this research Booshoot Gardens, LLC has already begun to find investors and expand the business into the U.S Paper...
- 84
- 472
- 0
santiago as a hemmingway code hero in the old man and the sea
... front of them They show the characteristics of a stoic, working hard in the hardest of situations Hemingway Code Heros are very rare in real life, but in fiction they survive, setting good examples ... far as the side of the boat The Old Man And The Sea portrays Hemingway Code Heros to their fullest potential As Heros they try their hardest to persevere under pressure and achieve the goal in ... offered each other the best of company While out at sea Santiago is constantlywishing the boy was there to talk to or to help with the mighty fish Santiago does not have relationships with any...
- 2
- 919
- 1
Báo cáo khoa học: Bioenergetic requirements of a Tat-dependent substrate in the halophilic archaeon Haloarcula hispanica pdf
... translation (see below), amyH was amplified using chromosomal DNA of H hispanica as template, and primers AmyH-T 7a (atatcatATGAATCGACCCCGAATTACC GGCAG) and AmyH-T7b (atataagcttGTCTCCGTGGCG TGCCAGCTTACTG), ... for adaptation of the Tat pathway to highly saline conditions If all haloarchaea use the SMF for Tat-dependent translocation, it is tempting to speculate that TatC2 has a role in linking protein ... Quickchange mutagenesis were AmyKKfor (CCGGCAGTAAGCAGGCGTCTaagaaaACC GTTCTGAAAGGAATCG) and AmyKKrev (GGCCGTC ATTCGTCCGCAGAttctttTGGCAAGACTTTCCTTAGC) (bold letters indicate the nucleotides encoding the...
- 9
- 414
- 0
Báo cáo khoa học: Purification and characterization of three isoforms of chrysophsin, a novel antimicrobial peptide in the gills of the red sea bream, Chrysophrys major doc
... FFGWLIKGAIXAGKAIXGLIXRRRX 2891.2 P2 FFGWLIRGAIXAGKAIXGLIXRRRX 2919.3 P3 FIGLLISAGKAIXDLIRRRX 2285.7 Peptide fragment ESI-ITMS Mr Calc Mr His (·) FFGWLIK GAIXAGK AIXGLIXRRRX FFGWLIRGAIXAGK AIXGLIXRRRX ... phenylthiohydantoin amino-acid standards Tricine/SDS/PAGE The molecular mass of the sample was estimated by Tricine/ SDS/PAGE using a 16.5% separating gel, 10% spacer gel and 4% stacking gel in the presence ... bacterial membrane, adopting an amphipathic a- helical conformation that allows them to insert the hydrophobic face into the lipid bilayers and form a pore [1,8,22] The amphipathic a- helical structure...
- 12
- 482
- 0
Báo cáo Y học: Calcium-binding by p26olf, an S100-like protein in the frog olfactory epithelium pot
... primers: AACTTCAAACAGTTTGAGCAG for EF -A- mutation, GACTTTCAACAGTTTCTCAAC for EF-B-mutation, GAT TACACACAGTTCGAGGCA for EF-C-mutation, AATTT CCAGCAGTTCATGAAC for EF-D-mutation The underlined codons ... 90% of the change in the a helix content was attained by binding of two Ca21 Interestingly, in the mutants which have only three Ca21-binding sites, the binding of two Ca21 was sufficient to induce ... basis of the number (n ) of the ligand bound to a receptor Therefore, for example, when the first Ca21-binding takes place at a certain EF-hand and then the second binding takes place at two other...
- 8
- 509
- 0
Báo cáo khoa học: Catalytic activation of human glucokinase by substrate binding – residue contacts involved in the binding of D-glucose to the super-open form and conformational transitions ppt
... variably enhanced affinity for Glc and increased Vmax [27,28] Finally, hGK is allosterically activated by free polyubiquitin chains assigned to their equilibrium binding to the ubiquitin-interacting motif ... (UIM) at helix 17, and the approximately 1.4-fold increase in Vmax and slightly increased affinity for Glc [30] may be explained by a destabilization of the interaction between this helix and helix ... and small (S)] enzyme, and thus the site of initiation of the global conformational transition; and (c) to gain some insight into how the local torsional stresses at the contact residues in the...
- 15
- 522
- 0
Báo cáo khoa học: A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona pptx
... applied to each lane Lane M, molecular mass standards; lane A, CBB staining; lane B, Stains -all staining; lane C, negative staining; lane D, Methyl green staining Arrows on the right side of the lanes ... 362–369 Samata T, Hayashi N, Kono M, Hasegawa K, Horita C & Akera S (1999) A new matrix protein family related to the nacreous layer formation of Pinctada fucata FEBS Lett 462, 225–229 Kono M, Hayashi ... signal peptide, comprising 19 amino acids, the N-terminal amino acid of the mature protein was expected to be Ala based on the prediction using neutral networks and hidden Markov models Eventually,...
- 13
- 425
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25