quá trình hoạt động của các đơn vị thuộc tct 90 91 10

BÀI 16 ĐỊNH LUẬT JUN-LEN XƠ

BÀI 16 ĐỊNH LUẬT JUN-LEN XƠ

Vật lý

... điện, ấm điện… toả nhiệt có ích, số thiết bò điện động điện thiết bò điện tử gia dụng toả nhiệt vô ích - Để tiết kiệm điện cần giảm toả nhiệt hao phí cách giảm điện trở nội, sử dụng dây dẫn có điện ... LEN-XƠ I Trường hợp điện biến đổi thành nhiệt - Nếu đo nhiệt lượng Q II/ Đònh luật Jun - Len-xơ: đơn vò calo hệ Q = I2Rt Hệ thức đònh luật : thức đònh luật Jun Xử lí kết thí Lenxơ nghiệm kiểm tra : ... gian (s) Q : nhiệt lượng (J) Xử lí kết thí nghiệm kiểm tra : Xử lí kết thí nghiệm kiểm tra : 55 60 10 50 45 15 40 20 35 25 30 I = 2,4A ; R = 5Ω K A V C1 : Điện A dòng điện chạy qua dây điện trở: ...
  • 18
  • 240
  • 0

đồ án tốt nghiệp công nghệ thông tin kết hợp hai phương pháp biến đổi sóng nhỏ dwtiwt và phương pháp trộn có chọn lọc cho phương pháp giấu ảnh trong ảnh 

đồ án tốt nghiệp công nghệ thông tin kết hợp hai phương pháp biến đổi sóng nhỏ dwtiwt và phương pháp trộn có chọn lọc cho phương pháp giấu ảnh trong ảnh 

Hệ thống thông tin

... giấu thông tin ảnh phụ thuộc vào hệ thống thị giác người Các kĩ thuật giấu tin ảnh thuộc vào nhóm: Giấu tin miền quan sát Các phương pháp dựa vào kĩ thuật biến đổi ảnh Các phương pháp sử dụng ... hai phƣơng pháp biến đổi sóng nhỏ DWT/IWT Quá trình trộn áp dụng cho tất ảnh tính toán ngƣợc DWT/IWT để đƣợc ảnh giấu tin Quá trình tách tin ngƣợc lại với trình nhúng tin mật Sự kết hợp hai phƣơng ... Trƣờng ĐHDL Hải Phòng + Quá trình trộn áp dụng cho hệ số ảnh gốc ảnh mật Sau sử dụng biến đổi ngƣợc DWT/IWT để đƣợc ảnh chứa tin mật Quá trình tách tin ngƣợc lại với trình nhúng tin mật 2.75.2...
  • 56
  • 328
  • 0

báo cáo đối tượng tối đại và ngữ nghĩa của cơ sở dữ liệu quan hệ phổ quát

báo cáo đối tượng tối đại và ngữ nghĩa của cơ sở dữ liệu quan hệ phổ quát

Quản trị mạng

... 8 -10 101 X Ng-v-A Giải thuật Ng-v-B 10- 12 101 Giải thuật 10- 12 101 Y CSDL Tran-v-C CSDL Ng-v-B Tran-v-C CSDL Q: (quan hệ phổ quát) GV-CT N G P M GV Ng-v-A 8 -10 101 Giải thuật X Ng-v-B 10- 12 101 ... 8 -10 101 X Ng-v-A Giải thuật Ng-v-B 10- 12 101 Giải thuật 10- 12 101 Y CSDL Tran-v-C CSDL Ng-v-B Tran-v-C CSDL Q: (quan hệ phổ quát) GV-CT N G P M GV Ng-v-A 8 -10 101 Giải thuật X Ng-v-B 10- 12 101 ... 8 -10 101 X Ng-v-A Giải thuật Ng-v-B 10- 12 101 Giải thuật 10- 12 101 Y CSDL Tran-v-C CSDL Ng-v-B Tran-v-C CSDL Vo-v-D 8 -10 103 Vo-v-D Giải thuật Q: (quan hệ phổ quát) GV-CT N G P M GV Ng-v-A 8-10...
  • 46
  • 538
  • 1

Nghiên cứu sự biến đổi thành phần hóa học, tính chất vật lý và đề xuất biện pháp nâng cao chất lượng cá Cơm săng (Spratelloides gracillis) sấy hồng ngoại xuất khẩu

Nghiên cứu sự biến đổi thành phần hóa học, tính chất vật lý và đề xuất biện pháp nâng cao chất lượng cá Cơm săng (Spratelloides gracillis) sấy hồng ngoại xuất khẩu

Tiến sĩ

... Thành phần Đơn vị Hàm lượng Hàm lượng nước % 76 Protein % 20.25 NH3 mg /100 g 4.65 Histamin ppm Lipit % 2.5 Carbohydrate % Tro % 2.4 Ca mg /100 g 279 P mg /100 g 246 10 Fe mg /100 g 1.2 11 Na mg /100 g 147 ... [129] Uchino CS (2000) [135] Daisuke CS (2001) [49] 1,72 ± 0,45 log10CFU/10g 4,04 ± 0,47 log10CFU/10g 1,26 ± 0,14 log10CFU/10g Gabel CS (2006) [63] 24 VSV Tổng VK tự nhiên Loại thực phẩm Nhiệt ... thái ban đầu, đồng thời giải phóng lượng, lượng tử định Nguyên tắc hoạt động hệ thống trình quang hóa xảy hệ thống Quá trình mô tả cách ước lệ sau: a+b ab + c ambncn + a hν1 hν2 ab Trong đó: abc...
  • 210
  • 901
  • 1

sự biến đổi thành phần hóa học trong chế biến nước trái cây

sự biến đổi thành phần hóa học trong chế biến nước trái cây

Sinh học

... Loại Ðộ Brix Ðường (%) Acid (%) PH Chín 1/2 13 8.31 4 .10 3.00 -7- Chín 3/4 Chín hồn tồn 16 17 10. 24 10. 88 3.40 2.66 3 .10 3.14 (Nguồn: Khảo sát q trình chế biến nước giải khát từ trái chanh dây – ... hóa học chanh dây Thành phần Đơn vị (tính 100 g ngun liệu tươi) Năng lượng 62 kcal Nước 75.9 g Protid 2.6 g Lipid 0.6 g Glucid 8.5 g Chất xơ 7.3 g Chất khống (mg) Natri 10 Kali 228 Đồng 0.13 Phospho ... non già ngồi Hoa dứa thuộc loại lưỡng tính, số lượng thay đổi từ 100 – 200 Hoa dứa khơng sinh sản nỗn khơng đậu cách lai phấn thụ tinh hình thành hạt tròn nhỏ cứng Quả dứa thuộc loại kép hình...
  • 19
  • 1,378
  • 15

Theo dõi sự biến đổi thành phần hóa học trong chế biến nước trái cây của công ty rau quả Cửu Long

Theo dõi sự biến đổi thành phần hóa học trong chế biến nước trái cây của công ty rau quả Cửu Long

Khoa học tự nhiên

... 16 17 8.31 10. 24 10. 88 4 .10 3.40 2.66 3.00 3 .10 3.14 (Nguồn: Khảo sát q trình chế biến nước giải khát từ trái chanh dây – lvtn 2002 – Bùi Thị Thuỳ Ngân) 3.2 Thời điểm thu hoạch Q trình sinh trưởng ... hóa học chanh dây Thành phần Đơn vị (tính 100 g ngun liệu tươi) Năng lượng 62 kcal Nước 75.9 g Protid 2.6 g Lipid 0.6 g Glucid 8.5 g Chất xơ 7.3 g Chất khống (mg) Natri 10 Kali 228 Đồng 0.13 Phospho ... non già ngồi Hoa dứa thuộc loại lưỡng tính, số lượng thay đổi từ 100 – 200 Hoa dứa khơng sinh sản nỗn khơng đậu cách lai phấn thụ tinh hình thành hạt tròn nhỏ cứng Quả dứa thuộc loại kép hình...
  • 19
  • 664
  • 2

NGHIÊN CứU BIếN ĐổI THàNH PHầN GEN H5 CủA VIRUS CúM A/H5N1 PHÂN LậP Từ Gà HậU GIANG SO SáNH VớI CáC CHủNG CủA VIệT NAM Và VùNG ĐÔNG NAM CHÂU á (2005 - 2008)

NGHIÊN CứU BIếN ĐổI THàNH PHầN GEN H5 CủA VIRUS CúM A/H5N1 PHÂN LậP Từ Gà HậU GIANG SO SáNH VớI CáC CHủNG CủA VIệT NAM Và VùNG ĐÔNG NAM CHÂU á (2005 - 2008)

Sinh học

... Giải trình trình tự v phân tích số liệu Trình tự nucleotide DNA plasmid đợc giải trình máy tự động ABI- 3100 Avant Genetic Analyzer (Applied Biosystems) Chuỗi nucleotide đợc xử lý chơng trình ... -* 980 * 100 0 * 102 0 * 104 0 * 106 0 * 108 0 A-Ck-VN-HG : TATGTGAAATCAACCAGATTAGTCCTTGCGACTGGGCTCAGAAATAGCCCTCAAAGAGAGAGAAGAAGAAAAAAGAGAGGATTATTTGGAGCTATAGCAGGTTTTATAGAAGGAGGATGG : 108 0 A-Ck-VN-LA ... .T G : 108 0 A-Dk-VN-CM : .A G .G : 108 0 A-Ck-VN-NC : .A - G G : 107 7 A-HN-3040- : .A - G : 107 7 A-Ck-TL-No : .A A .A G : 108 0 A-mDk-VN-B...
  • 8
  • 487
  • 0

Bài báo cáo những biến đổi thành phần hóa học tôm sú ppt

Bài báo cáo những biến đổi thành phần hóa học tôm sú ppt

Ngư nghiệp

... Thành phần chủ yếu lipid động vật thủy sản triglicerit acid béo bậc cao hóa hợp với glicerin - Qúa trình thủy phân lipit tạo glycerin + axit béo tự đăc biệt axit butyric Quá trình oxi hóa lipit sinh ... biến đen, biến vàng Biến đổi màu sắc ghẹ kết trình oxy hóa phản ứng có enzime xúc tác Màu vàng kết trình oxy hóa carotenoid ghẹ Màu nâu tối màu đen trình oxy hóa amino acid tyrosine phenylalanyne ... 16,9 20 .91 16 0,37 1.68 1.56 1,9 1.32 1,5 Nước(%) Vô cơ(%) (72,31 ÷ 77,29) (1 ,91 ÷ 2,21) 80,8 78.54 77.38 78,5 77.16 79.57 1,8 1.81 1.75 2,2 1.56 1.63   •Ngoài có lượng nhỏ glucid, vitamin ,các chất...
  • 27
  • 606
  • 1

Bài báo cáo Seminar "Những biến đổi thành phần hóa học tôm sú" ppsx

Bài báo cáo Seminar

Ngư nghiệp

... Thành phần chủ yếu lipid động vật thủy sản triglicerit acid béo bậc cao hóa hợp với glicerin - Qúa trình thủy phân lipit tạo glycerin + axit béo tự đăc biệt axit butyric Quá trình oxi hóa lipit sinh ... biến đen, biến vàng Biến đổi màu sắc ghẹ kết trình oxy hóa phản ứng có enzime xúc tác Màu vàng kết trình oxy hóa carotenoid ghẹ Màu nâu tối màu đen trình oxy hóa amino acid tyrosine phenylalanyne ... triển sử dụng chất thịt làm nguồn dinh dưỡng cho trình trao đổi chất chúng 4/ Biến đổi Protein:  Dưới tác động yếu tố vật lý, hóa học, sinh học, trình thủy phân phân giải protein diễn nhanh dễ...
  • 27
  • 1,628
  • 9

Biến đổi thành phần hóa học của tôm hùm pdf

Biến đổi thành phần hóa học của tôm hùm pdf

Ngư nghiệp

... kiềm hãm ,ức chế hoạt động vi sinh vật ,của enzym ,nguyên nhân gây biện đổi cua thành phần tôm Biện pháp kiểm soát biến đen tôm: Có cách : • Bảo quản tôm đá xay hoăc đá vẩy thùng cách nhiệt có ... :chống vi sinh vật,chống oxi hóa ,hạn chế hoạt động xúa tác enzym ,hạn chế biến đen tôm Cơ chế chống biến đen tôm sulfit: Các phương pháp kiểm soát hoạt động enzyme va ci sinh vật: Dùng nhiệt độ ... Dùng nhiệt độ thấp:Nhiệt độ ảnh hưởng trực tiếp đến hoạt động enzym phát triển vi sinh vật Khi nhiệt độ thấp ,chúng bị ức chế đình hoạt động ,các phản ứng sinh hóa diễn chậm nhiệt độ thấp bảo...
  • 5
  • 646
  • 2

NGHIÊN cứu sự BIẾN đổi THÀNH PHẦN HOÁ học, CHẤT LƯỢNG cảm QUAN và PHƯƠNG PHÁP bảo QUẢN tươi cá TRA (pangasius hypophthalmus) SAU THU HOẠCH

NGHIÊN cứu sự BIẾN đổi THÀNH PHẦN HOÁ học, CHẤT LƯỢNG cảm QUAN và  PHƯƠNG PHÁP bảo QUẢN tươi cá TRA  (pangasius hypophthalmus) SAU THU HOẠCH

Công nghệ - Môi trường

... tạng cá sống cá vừa đánh bắt lên biến động phạm vi:  Trên da: 102 – 107 vi sinh vật/cm2  Trên mang: 103 – 109 vi sinh vật/gam  Trong nội tạng: 103 – 109 vi sinh vật/gam Sau giai đoạn tiềm ... độ khoảng -2,10C Quá trình bảo quản cá 00C điểm đóng băng gọi trình làm lạnh thấp (superchilling) điều cho phép tăng đáng kể thời gian bảo quản Về nguyên tắc, tạo trình làm lạnh cách sử dụng ... độ :  10C 43 Sơ đồ bố trí chế độ bảo quản cá nhiệt độ :  10C 44 Sơ đồ bố trí chế độ bảo quản cá nhiệt độ :28  20C 45 Quy trình bảo quản cá tra ứng dụng thực tế 79 DANH MỤC CÁC KÝ HIỆU, CÁC CHỮ...
  • 109
  • 614
  • 2

SỰ BIẾN ĐỔI THÀNH PHẦN HÓA HỌC CỦA NGUYÊN LIỆU ẢNH HƯỞNG ĐẾN CHẤT LƯỢNG CỦA CHÚNG.NHỮNG BIỆN PHÁP HẠN CHẾ SỰ BIẾN ĐỔI ĐÓ

SỰ BIẾN ĐỔI THÀNH PHẦN HÓA HỌC CỦA NGUYÊN LIỆU ẢNH HƯỞNG ĐẾN CHẤT LƯỢNG CỦA CHÚNG.NHỮNG BIỆN PHÁP HẠN CHẾ SỰ BIẾN ĐỔI  ĐÓ

Địa lý

... chúng hoạt động xúc tác cho phản ứng hóa học nội tạng thịt Enzyme tham gia vào trình trao đổi chất tế bào, trình tiêu hóa thức ăn tham gia vào trình tê cứng Sau cá chết enzyme hoạt động gây nên trình ... trưng cho phạm chất động vật thủy sản sau chết, khả bào quản chúng phụ thuộc vào trị số pH • Khi pH tổ chức thịt hạ thấp tạo điều kiện thuận lợi cho men kthepsin hoạt động thúc đẩy trình tự chín thịt ... hệ thống enzym vi sinh vật chất hoạt động sinh vật khác Các yếu tố ảnh hưởng như: độ tuổi, giống(đực, cái), mùa vụ, thức ăn, hoàn cảnh sinh sống vị trí thể II Các thành phần hóa học biện pháp...
  • 55
  • 1,718
  • 2

nghiên cứu sự biến đổi thành phần saponin của sâm việt nam (panax vietnamesnsis) trong quá trình chế biến

nghiên cứu sự biến đổi thành phần saponin của sâm việt nam (panax vietnamesnsis) trong quá trình chế biến

Báo cáo khoa học

... 2.1.3.6 Tác động hệ tim mạch tác động phòng chống xơ vữa động mạch Sâm Việt Nam có tác động co mạch nồng độ thấp giãn mạch nồng độ cao 31 Sâm Việt Nam thể tác dụng phòng chống xơ vữa động mạch ... phần saponin sâm Việt Nam thuộc loại saponin triterpen, chủ yếu saponin thuộc nhóm dammaran lượng nhỏ thuộc nhóm oleanan Hầu hết saponin biết tìm thấy phân lập từ loài thuộc chi Panax, riêng gypenosid ... dụng: Liều thấp (10- 100 mg/kg): kích thích nhẹ hệ thần kinh trung ương Liều cao (trên 100 mg/kg): ức chế hệ thần kinh trung ương Formatted: Bullets and Numbering 1.2.3.3.Tác động tăng lực hồi...
  • 75
  • 497
  • 2

Phân tích các biến đổi hình thái học và sinh lý học trong các quá trình phát sinh cơ quan và phôi thể hệ ở một số giống chuối (Musa sp.)

Phân tích các biến đổi hình thái học và sinh lý học trong các quá trình phát sinh cơ quan và phôi thể hệ ở một số giống chuối (Musa sp.)

Tiến sĩ

... (méristème médullaire) Các tế bào vùng trung tâm không hoạt động giai đoạn tăng trưởng dinh dưỡng hoạt động trở nên mạnh mẽ vào giai đoạn hoa (cho phận hoa) [118] Khái niệm mô phân sinh động (dynamic ... ngoại sinh [17], [41], [100 ], [102 ] Theo Nozeran [152], trình phát triển, có tác động qua lại quan thực vật, cấu trúc toàn vẹn thể thực vật toàn tương tác cấu trúc hợp thành Các nhân tố di truyền ... cầu với biểu bì hóa 101 Hình 3.64 Chi tiết phôi hình cầu với biểu bì hóa 101 xvi Hình 3.65 Phôi hợp tử chuối Hột 30 ngày tuổi 101 Hình 3.66 Quá trình hình thành mô phân sinh...
  • 150
  • 422
  • 2

khảo sát sự biến đổi thành phần hóa học giống đậu nành mtđ 7604 (glycine max) theo thời gian nẩy mầm

khảo sát sự biến đổi thành phần hóa học giống đậu nành mtđ 7604 (glycine max) theo thời gian nẩy mầm

Khoa học tự nhiên

... thí nghiệm Sinh Hóa giúp đỡ động viên em nhiều suốt trình thực đề tài Xin gửi lời cảm ơn sâu sắc đến ba mẹ quan tâm, động viên chỗ dựa tinh thần vật chất cho suốt trình học tập trường Xin chân ... phẩm Quá trình nẩy mầm từ lâu xem phương pháp đơn giản rẻ tiền việc cao giá trị dinh dưỡng làm giảm yếu tố không mong muốn [3] Tuy nhiên, ảnh hưởng nẩy mầm thời gian ngắn lên thành phần có hoạt ... Trong trình nẩy mầm, số thay đổi số lượng chất lượng xảy hạt giống Những thay đổi phụ thuộc vào loại hạt giống điều kiện nẩy mầm Đặc trưng biến đổi hóa sinh nẩy mầm tăng đột ngột hoạt động thủy...
  • 55
  • 424
  • 0

Nghiên cứu sự biến đổi thành phần hóa lý của tỏi (allium sativum) phan rang theo thời gian lên men

Nghiên cứu sự biến đổi thành phần hóa lý của tỏi (allium sativum) phan rang theo thời gian lên men

Công nghệ thực phẩm

... mL, 100 mL - Ống đong 250 mL, 100 mL, 10 mL - Ống nghiệm thủy tinh - Ống Falcon đựng mẫu 50 mL - Ống nhựa ly tâm 50 mL - Pipet 10 mL, mL, mL - Cuvet thạch anh - Micropipet (10 - 100 ߤ݈, 100 – ... quy trình tổng quát lên men sản xuất tỏi đen Quy trình lên men sản xuất tỏi đen tổng quát thể Hình 2.2 Tỏi nguyên liệu Xử lý Lên men Sấy khô Bao gói Sản phẩm Hình 2.2 Sơ đồ quy trình tổng quát ... S-Allyl cysteine tính chất hóa lý tỏi đen trình xử lý nhiệt” [10] , nhà khoa học Trung Quốc Lei cộng nghiên cứu “ Các phân tích Saccharide tỏi đen hoạt động chống ôxy hóa nó” [20]…v.v Tỏi đen sử...
  • 68
  • 1,024
  • 6

Sự biến đổi thành phần hóa học ở tôm sau khi sấy

Sự biến đổi thành phần hóa học ở tôm sau khi sấy

Hóa học - Dầu khí

... mùi vị giảm 06/12/2012 Biến đổi sinh hóa Giai đoạn sau sấy: số enzym enzym oxy hóa khử không bất hoạt hoàn toàn mà tiếp tục hoạt động yếu thời gian bảo quản tới giai đoạn phục hồi khả hoạt động ... làm cho sp có mùi vị ôi, thối, đắng khét, giảm giá trị thực phẩm - Nhiệt độ cao oxy hóa nhanh 3.Sự biến đổi thành phần chất ngấm - Hàm lượng số chất ngấm giảm xuống - Quá trình sấy khô kéo dài ... nước bị giảm dần Vd: p.ứ thủy phân 06/12/2012 Sự biến đổi protein Dưới tác động yếu tố vật lý, hóa học, sinh học, trình thủy phân phân giải protein diễn nhanh dễ dàng đặc biệt tác dụng emzym...
  • 5
  • 297
  • 0

Xem thêm