... 3H-thymidine was added to each well and the plates harvested 18 h later Irradiated PBMC from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of ... static flasks as before using ITIP maturation The floating cells were harvested and stained for DC maturation markers without fixation Immediately before FACS analysis µg/ml 7-ADD was added as ... T-cell-based immune responses against viral disease and cancer [1] Recently, this powerful ability of DC is being tested as an active vaccine approach to treat cancer and viral infections such as...
... there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by the field that it radiated, then ... contact transformations,” which has an important quantum mechanical analogue, namely, the transformation matrix (qt |qT ) This matrix connects a representation with the variables q diagonal at ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal...
... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central concern ... Graduation paper Declaration Title: Anewapproach to semantic and syntactic functions of English adjectives A contrastive analysis with their Vietnamese equivalents (Graduation paper submitted...
... implementing a transformation: the Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management ... Representatives, David E McNabb entered a second career in academia He advanced to the rank of professor on the faculty at Pacific Lutheran University He has a BA from California State College at Fullerton, ... impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any one can doom...
... Gender-Based Approach , Sexual Health Exchange 1998, no 2, pp 3–6 83 T Valdés and J Olvarríra, eds, “Masculinidades y equidad de genéro en America Latina” 21 Partnering: ANewApproach To Sexual And ... Non-governmental organization PHC Primary health clinic Profamila/DR Asociatión Dominicana Pro-Bienestar de la Familia/Dominican Republic RFSU Swedish Family Planning Association SAARC South Asia Association ... Model of Masculinity and New Paradigms of Fatherhood 119 Old Paradigm: Masculinity New Paradigm: Fatherhood Primary and sole financial provider Authoritarian disciplinarian Shares financial-provider...
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... 119–128 24 Zhang T, Maekawa Y, Hanba J, Dainichi T, Nashed BF, Hisaeda H, Sakai T, Asao T, Himeno K, Good RA & Katunuma N (2000) Lysosomal cathepsin B plays an important role in antigen processing,...
... MUSE, a new, GAbased approach to multilingual extractive summarization We evaluated the proposed methodology on two languages from different language families: English and Hebrew The experimental ... of Language Resources and Evaluation We are grateful to Michael Elhadad and Galina Volk from Ben-Gurion University for providing the ROUGE toolkit adapted to the Hebrew alphabet, and to Slava Kisilevich ... Workshop on Text Summarization Branches Out (WAS 2004), pages 25–26 K Filippova, M Surdeanu, M Ciaramita, and H Zaragoza 2009 Company-oriented extractive summarization of financial news In Proceedings...
... paragraphs Table 3: Answer Extraction from Top N documents Feature set Match TE (DF) Top N paragraphs Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact ... Della Pietra: A Maximum Entropy Approach to Natural Language Processing, Computational Linguistics, Vol 22, No 1, pp 39–71 (1996) 221 Abdessamad Echihabi and Daniel Marcu: A NoisyChannel Approach ... (NICT), Japan A machine learning approach to hierarchical question analysis was reported in (Suzuki et al., 2003), but training and maintaining an answer extractor for question types of fine granularity...
... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... the 25th Annual Meeting of ACL, pages 123-130, Stanford, California Eiichiro Sumita, Hitoshi Iida, and Hideo Kohyama 1990 Translating with examples: Anewapproach to machine translation In Proceedings ... the parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, anew beta-lactam compound II Separation and purification of L-amino acid acylase ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an...
... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of ... ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra 'The man is shooting the kangaroo while it is eating grass.' Figure 2b is the syntactic representation for that sentence Note that the...
... designators: Its clause number (C), A Status Flag (v) to indicate whether the predicate of the clause has or has not occurred, Its phrase number (P), and A Backward Flag (b) to indicate a particular ... correspondents are enclosed in brackets They may appear as some combination of the following word-sections: aa translated initial prefix b a transliterated full or partial stem c a transliterated full ... indicates that anew clause is starting, the predictions of anew subject and predicate are entered as foresights b The main routine This may yield predictions of a general nature on the basis...
... selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion ... of as a bottom-up approachfrommolecular level interactions to microscopic and macroscopic phenomena in paper, and to the properties of paper as a material In this thesis of basic research, an ... like to thank everyone involved, especially Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences,...
... constructed as follows The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total...
... the attack tree considering the Ma a as the attacker It assumes all the normal parties in the transaction (the merchant, the customer and the bank) are trusted and that attacks come froma third ... to be lax about changing the default passwords Because the administration interface is nearly always web-based, this opens up some attacks As Stamm et al [30] have shown, if Javascript can be ... containing the form data, rather than just the form data, not all services can be attacked this way Internal webbased services are vulnerable, which many appliances are deploying The other category...
... undertake, as far as possible before formal legal powers are created, the permanent body’s macro-prudential role, in addition to vital preparatory work and analysis into potential macro-prudential ... will be taking, the Bank of England and the FSA has published a paper detailing the approach to be taken to banking supervision (which was published on 19 May and is available on the FSA website), ... regulators to determine applications for approval made by persons also applying for Part 4A permission to the same timetable as the authorisation application (as set out at new section 55V as inserted...
... the termination and initiation codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce ... encoded by aq477, was annotated as a protein of unknown function with amolecular mass of 12 804 Da as deduced from the amino acid sequence Mass spectra of each fraction demonstrated one major protein ... polyacrylamide gel of the puried Aq-477 fromA aeolicus (A) SDS polyacrylamide gel of the puried recombinant Aq-477 Lane 1, molecular mass markers (in kDa); lane 2, lg of recombinant Aq-477; lane...
... No-Fault Insurance Grossi, Patricia and Kunreuther, Howard: Catastrophe Modeling: ANewApproach to Managing Risk CATASTROPHE MODELING: ANEWAPPROACH TO MANAGING RISK PATRICIA GROSSI HOWARD ... special thanks for their encouragement and understanding Patricia Grossi Howard Kunreuther Prelude The aftermath of a natural disaster, such as an earthquake, flood, hurricane, can be devastating ... their goals for risk management Throughout the chapter, there is an emphasis on understanding catastrophe modeling for earthquake and hurricane hazards and how it is used to manage natural hazard...