psychology as a science sandwiched among the quot turtles all the way down quot
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
Ngày tải lên :
03/04/2013, 21:06
... first and half ate the heightened aroma samples first The subjects were asked to rate one sample a day at any time of the day they wanted Similarly to the tasting sessions, As the final task in the ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and intake of a...
- 10
- 599
- 1
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
Ngày tải lên :
13/02/2014, 05:20
... Races Theories of monogenism and polygenism Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, ... Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences of the migrations of races and nations a The Eurafrican Race.—Types of the white race Its first home Early migrations The South ... Mediterranean branch (Hamitic and Semitic stocks) The North Mediterranean branch (Euskaric, Aryan, and Caucasic stocks) b The Austafrican Race.—Former geography of Africa The Negrillos or Pigmies The...
- 28
- 665
- 0
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt
Ngày tải lên :
17/02/2014, 03:20
... case studies that form the basis for the findings The eight central banks covered are: the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European Central Bank, the Bank ... deposits in the facility was initially set at 100 basis points below the official repo rate, which was the main policy rate at the time, whereas the rate charged in the lending facility was 100 basis ... rates has remained positive Bank of Japan The Bank of Japan (exhibits 3a and 3b) has long had a Complementary Lending Facility, which offers loans at a rate that is normally 25 basis points above...
- 49
- 653
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were ... Denmark) DNA techniques All manipulations were performed as described by Sambrook et al [24] Taq DNA polymerase (New England Biolabs, Frankfurt am Main, Germany) was applied for analytical purposes...
- 12
- 616
- 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
Ngày tải lên :
24/02/2014, 18:20
... achieving the outcomes Learners as individuals will follow different pathways to achieving these outcomes Standard Australian English is the national language of Australia and it is essential that all ... important to ascertain how much language they are using at home If necessary use a bilingual worker to talk with the family and establish what language the child speaks at home, ask the family ... each child Assessment of learning includes reviewing, gathering and analysing information about what the learner can do, what they understand and the progress they are making at any particular...
- 31
- 1K
- 2
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... base and on the cytoplasmic ring, respectively Height indicates the vertical distance between the NPC cytoplasmic surface and the base Scale bar = 50 nm (D) The outer diameter was measured and...
- 12
- 454
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular ... °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired t-test (a ¼ 0.05) with the Bonferroni adjustment was ... correct assessment and comparison of the levels of the thermally and chemically induced primary changes in the membrane physical orders, we used isolated membranes As shown by Fig 1A, the plasma membrane...
- 10
- 452
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
Ngày tải lên :
07/03/2014, 15:20
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...
- 8
- 426
- 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
Ngày tải lên :
07/03/2014, 15:20
... scintillation uid The lter-bound radioactivity was measured on Tracor Analytic Delta 300 scintillation counter (ThermoQuest/CE Instruments, Piscataway, USA) and the amount of methylated DNA was determined ... methylation was calculated as the ratio of radioactivity of duplex VIm to the radioactivity of duplex Vm Methylation of duplex Vm (not shown) was accepted as 100% The research was supported by a ... Nucleic Acids Res 20, 32413248 12 Wyszynski, M.W., Gabbara, S., Kubareva, E .A. , Romanova, E .A. , Oretskaya, T.S., Gromova, E.S., Shabarova, Z .A & Bhagwat, A. S (1993) The cysteine conserved among DNA...
- 9
- 437
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... of the wastewater problems near shrimp ponds. These are: (i) Spatial boundaries: the location of the shrimp farms has to stay nearby the river estuaries; The available space ... among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ...
- 13
- 487
- 0
Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx
Ngày tải lên :
22/03/2014, 16:20
... RT-PCR using PlatiniumÒ Taq DNA High Fidelity Polymerase (Invitrogen) and the primers: PDZ-1-2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; ... mutagenic primers were: GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT GTGA-3¢ and ... 5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers 2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers 3, forward: 5¢-ACCAGATGGTGAGAGCGAT-3¢, and reverse: 5¢-CTGTCTTTCATAGGTCCCAAT-3¢...
- 11
- 419
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
Ngày tải lên :
23/03/2014, 15:21
... Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella ... red algal protein than with the cyanobacterial one The C paradoxa thylakoid membranes also contained a band cross-reacted with anti-(R-PsbQ¢), the apparent molecular mass of which was remarkably ... Maruyama S, Takahara M, Miyagishima SY, Mori T, Nishida K, Yagisawa F, Nishida K, Yoshida Y et al (2004) Genome sequence of the ultrasmall unicellular red alga Cyanidioschyzon merolae 10D Nature...
- 11
- 501
- 0
mathematics as a science of patterns sep 1997
Ngày tải lên :
11/06/2014, 09:52
... for a defence of mathematical realism.7 Now the only reason that mathematical realists need worry about truth is that they want to affirm that various mathematical theories are true Although these ... less than this opens the way to antirealist, constructive accounts of mathematics Moreover, accepting classical analysis already suffices for making a convincing case that the mathematical realm ... philosophers of mathematics to disdain realism about mathematical objects, and to not read mathematics at face value Hartry Field has embraced an ingenious version of the view that mathematics is a useful...
- 300
- 1.4K
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific ... to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the...
- 12
- 573
- 0
Báo cáo hóa học: " Effects of pentacene-doped PEDOT:PSS as a holeconducting layer on the performance characteristics of polymer photovoltaic cells" pot
Ngày tải lên :
20/06/2014, 23:20
... 5.5 mg, the pentacene-doped PEDOT:PSS thin film was thermally annealed As the annealing temperature was increased, the polymer aggregate or grain size also increased, and eventually, the continuous ... 1,2-dichlorobenzene as a solvent were purchased from Sigma-Aldrich (Seoul, South Korea) P3HT as an electron donor was purchased from Rieke Metal Inc (Lincoln, NE, USA) PCBM as an electron acceptor was purchased ... Nano-C (Westwood, MA, USA) Aluminum as a cathode was purchased from CERAC™, Inc (Milwaukee, WI, USA) Device fabrication The pre-patterned ITO glass substrates were cleaned with acetone, ethanol,...
- 8
- 401
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
Ngày tải lên :
23/06/2014, 00:20
... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... Rn , then (x ,xn ) ∈ Rn and by the transitivity, (x ,x) ∈ Rn for all n ∈ N0 which, by (ii), yields that x = x Actually, a minor modification of the above proof shows that the assumptions of Theorem ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem...
- 6
- 268
- 0
Báo cáo lâm nghiệp: "old hardiness as a factor for assessing the potential distribution of the Japanese pine sawyer Monochamus alternatus (Coleoptera: Cerambycidae) in China" pdf
Ngày tải lên :
07/08/2014, 16:20
... 1st–31st January 2004 Figure The potential distribution and dispersal areas of Monochamus alternatus in China Based on –10 and –4 ◦ C isotherms of January mean air temperature (Climatological Atlas ... and potential dispersal areas of the beetle This is similar to swallowtail butterfly, Papilio canadensis and P glaucus in Canada [12] The ability to survive at low temperature is a critical factor ... determining the geographical range of the beetle Meteorological data showed that local minimum temperature generally decreased with increasing latitude in eastern China (Climatic Atlas of the People’s...
- 8
- 343
- 0
Báo cáo y học: "Evaluation of recombinant invasive, non-pathogenic Eschericia coli as a vaccine vector against the intracellular pathogen, Brucella" pptx
Ngày tải lên :
11/08/2014, 08:21
... integrins, invasin activates signaling cascades One signaling pathway causes activation of components of focal adhesion complexes including Src, focal adhesion kinase, and cytoskeletal proteins, leading ... gentamicin to kill extracellular bacteria For invasion assays, cells were incubated for an additional 90 to kill extracellular bacteria, then washed and lysed in 200 μl of 1% triton X100 for at ... protection against a B abortus challenge Vet Microbiol 2000, 76(2):193-199 Cassataro J, Velikovsky CA, de la Barrera S, Estein SM, Bruno L, Bowden R, Pasquevich KA, Fossati CA, Giambartolomei GH: A DNA...
- 14
- 386
- 0